ID: 1056871729

View in Genome Browser
Species Human (GRCh38)
Location 9:90288065-90288087
Sequence TACTGGAACTCTTTCCCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056871723_1056871729 3 Left 1056871723 9:90288039-90288061 CCAGCCACAGAGACAGCATCCTA No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871724_1056871729 -1 Left 1056871724 9:90288043-90288065 CCACAGAGACAGCATCCTATTCT No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871718_1056871729 19 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871720_1056871729 9 Left 1056871720 9:90288033-90288055 CCTGCCCCAGCCACAGAGACAGC No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871719_1056871729 18 Left 1056871719 9:90288024-90288046 CCATCAGAGCCTGCCCCAGCCAC No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871722_1056871729 4 Left 1056871722 9:90288038-90288060 CCCAGCCACAGAGACAGCATCCT No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871721_1056871729 5 Left 1056871721 9:90288037-90288059 CCCCAGCCACAGAGACAGCATCC No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056871729 Original CRISPR TACTGGAACTCTTTCCCTCG GGG Intergenic
No off target data available for this crispr