ID: 1056874847

View in Genome Browser
Species Human (GRCh38)
Location 9:90318408-90318430
Sequence CTAAGGTCCTTACTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056874842_1056874847 -4 Left 1056874842 9:90318389-90318411 CCTGTTGGGCTTCCCACGACTAA No data
Right 1056874847 9:90318408-90318430 CTAAGGTCCTTACTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056874847 Original CRISPR CTAAGGTCCTTACTGGCTGC TGG Intergenic
No off target data available for this crispr