ID: 1056877614

View in Genome Browser
Species Human (GRCh38)
Location 9:90349681-90349703
Sequence TGTCCCAGGAAGCACCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056877607_1056877614 28 Left 1056877607 9:90349630-90349652 CCTGTGGTCCCCACTTCTGTCTG No data
Right 1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG No data
1056877610_1056877614 18 Left 1056877610 9:90349640-90349662 CCACTTCTGTCTGAACTCAGCTA No data
Right 1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG No data
1056877608_1056877614 20 Left 1056877608 9:90349638-90349660 CCCCACTTCTGTCTGAACTCAGC No data
Right 1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG No data
1056877609_1056877614 19 Left 1056877609 9:90349639-90349661 CCCACTTCTGTCTGAACTCAGCT No data
Right 1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056877614 Original CRISPR TGTCCCAGGAAGCACCTGGA TGG Intergenic
No off target data available for this crispr