ID: 1056879729

View in Genome Browser
Species Human (GRCh38)
Location 9:90379717-90379739
Sequence ATGTAAGCTCTGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056879722_1056879729 25 Left 1056879722 9:90379669-90379691 CCTGCAGCATGTCATCCTGGGTG No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data
1056879726_1056879729 10 Left 1056879726 9:90379684-90379706 CCTGGGTGTGCCTGGTTGGTGGT No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data
1056879721_1056879729 26 Left 1056879721 9:90379668-90379690 CCCTGCAGCATGTCATCCTGGGT No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data
1056879716_1056879729 29 Left 1056879716 9:90379665-90379687 CCCCCCTGCAGCATGTCATCCTG No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data
1056879717_1056879729 28 Left 1056879717 9:90379666-90379688 CCCCCTGCAGCATGTCATCCTGG No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data
1056879727_1056879729 0 Left 1056879727 9:90379694-90379716 CCTGGTTGGTGGTCGTGACTCAA No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data
1056879719_1056879729 27 Left 1056879719 9:90379667-90379689 CCCCTGCAGCATGTCATCCTGGG No data
Right 1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056879729 Original CRISPR ATGTAAGCTCTGATTGAGGA TGG Intergenic
No off target data available for this crispr