ID: 1056879828

View in Genome Browser
Species Human (GRCh38)
Location 9:90380517-90380539
Sequence CTGGGGGTGGGGAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056879828_1056879839 -3 Left 1056879828 9:90380517-90380539 CCTTCCAACTTCCCCACCCCCAG No data
Right 1056879839 9:90380537-90380559 CAGCTGATGGGACAGAGCCTAGG No data
1056879828_1056879840 8 Left 1056879828 9:90380517-90380539 CCTTCCAACTTCCCCACCCCCAG No data
Right 1056879840 9:90380548-90380570 ACAGAGCCTAGGACTCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056879828 Original CRISPR CTGGGGGTGGGGAAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr