ID: 1056879828 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:90380517-90380539 |
| Sequence | CTGGGGGTGGGGAAGTTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056879828_1056879839 | -3 | Left | 1056879828 | 9:90380517-90380539 | CCTTCCAACTTCCCCACCCCCAG | No data | ||
| Right | 1056879839 | 9:90380537-90380559 | CAGCTGATGGGACAGAGCCTAGG | No data | ||||
| 1056879828_1056879840 | 8 | Left | 1056879828 | 9:90380517-90380539 | CCTTCCAACTTCCCCACCCCCAG | No data | ||
| Right | 1056879840 | 9:90380548-90380570 | ACAGAGCCTAGGACTCTTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056879828 | Original CRISPR | CTGGGGGTGGGGAAGTTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||