ID: 1056886565

View in Genome Browser
Species Human (GRCh38)
Location 9:90448962-90448984
Sequence CTTGTTGCCCAACTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056886561_1056886565 3 Left 1056886561 9:90448936-90448958 CCTCTGCTTTGGTGGTGTTTCTG No data
Right 1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG No data
1056886560_1056886565 9 Left 1056886560 9:90448930-90448952 CCGGAGCCTCTGCTTTGGTGGTG No data
Right 1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG No data
1056886557_1056886565 20 Left 1056886557 9:90448919-90448941 CCTTGAGGTAACCGGAGCCTCTG No data
Right 1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056886565 Original CRISPR CTTGTTGCCCAACTGGAGCA AGG Intergenic
No off target data available for this crispr