ID: 1056887430

View in Genome Browser
Species Human (GRCh38)
Location 9:90456970-90456992
Sequence TCACCCTGCATTGCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056887430_1056887442 19 Left 1056887430 9:90456970-90456992 CCTGTCCCTGCAATGCAGGGTGA No data
Right 1056887442 9:90457012-90457034 ACAGGATGCCATCCATCATAGGG No data
1056887430_1056887436 1 Left 1056887430 9:90456970-90456992 CCTGTCCCTGCAATGCAGGGTGA No data
Right 1056887436 9:90456994-90457016 AGGTGGAGCCCACCCTGGACAGG No data
1056887430_1056887435 -4 Left 1056887430 9:90456970-90456992 CCTGTCCCTGCAATGCAGGGTGA No data
Right 1056887435 9:90456989-90457011 GTGAAAGGTGGAGCCCACCCTGG No data
1056887430_1056887441 18 Left 1056887430 9:90456970-90456992 CCTGTCCCTGCAATGCAGGGTGA No data
Right 1056887441 9:90457011-90457033 GACAGGATGCCATCCATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056887430 Original CRISPR TCACCCTGCATTGCAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr