ID: 1056888750

View in Genome Browser
Species Human (GRCh38)
Location 9:90469619-90469641
Sequence GTGGTGAGCAGCAGAAATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056888741_1056888750 17 Left 1056888741 9:90469579-90469601 CCCTGGGTCTCCCAGGCCGTTCT No data
Right 1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG No data
1056888740_1056888750 18 Left 1056888740 9:90469578-90469600 CCCCTGGGTCTCCCAGGCCGTTC No data
Right 1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG No data
1056888745_1056888750 6 Left 1056888745 9:90469590-90469612 CCAGGCCGTTCTTAATGAGGCAA No data
Right 1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG No data
1056888744_1056888750 7 Left 1056888744 9:90469589-90469611 CCCAGGCCGTTCTTAATGAGGCA No data
Right 1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG No data
1056888748_1056888750 1 Left 1056888748 9:90469595-90469617 CCGTTCTTAATGAGGCAAAGGGA No data
Right 1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG No data
1056888742_1056888750 16 Left 1056888742 9:90469580-90469602 CCTGGGTCTCCCAGGCCGTTCTT No data
Right 1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056888750 Original CRISPR GTGGTGAGCAGCAGAAATGT CGG Intergenic
No off target data available for this crispr