ID: 1056899393

View in Genome Browser
Species Human (GRCh38)
Location 9:90584012-90584034
Sequence CAGGGTATCCACAGGGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056899393_1056899402 3 Left 1056899393 9:90584012-90584034 CCAGCGACCCTGTGGATACCCTG No data
Right 1056899402 9:90584038-90584060 GGTCCAGGTATGCACTGCCGTGG No data
1056899393_1056899408 25 Left 1056899393 9:90584012-90584034 CCAGCGACCCTGTGGATACCCTG No data
Right 1056899408 9:90584060-90584082 GTGGCCTTTGTGGTCAGGAGAGG No data
1056899393_1056899404 6 Left 1056899393 9:90584012-90584034 CCAGCGACCCTGTGGATACCCTG No data
Right 1056899404 9:90584041-90584063 CCAGGTATGCACTGCCGTGGTGG No data
1056899393_1056899405 15 Left 1056899393 9:90584012-90584034 CCAGCGACCCTGTGGATACCCTG No data
Right 1056899405 9:90584050-90584072 CACTGCCGTGGTGGCCTTTGTGG No data
1056899393_1056899407 20 Left 1056899393 9:90584012-90584034 CCAGCGACCCTGTGGATACCCTG No data
Right 1056899407 9:90584055-90584077 CCGTGGTGGCCTTTGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056899393 Original CRISPR CAGGGTATCCACAGGGTCGC TGG (reversed) Intergenic
No off target data available for this crispr