ID: 1056900790

View in Genome Browser
Species Human (GRCh38)
Location 9:90597458-90597480
Sequence CCCATCAGGTGCCGCGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056900785_1056900790 -2 Left 1056900785 9:90597437-90597459 CCCTGCTTGTCATGCATCACACC No data
Right 1056900790 9:90597458-90597480 CCCATCAGGTGCCGCGTCATGGG No data
1056900783_1056900790 16 Left 1056900783 9:90597419-90597441 CCTTCAGGAGAAGGGCACCCCTG No data
Right 1056900790 9:90597458-90597480 CCCATCAGGTGCCGCGTCATGGG No data
1056900784_1056900790 -1 Left 1056900784 9:90597436-90597458 CCCCTGCTTGTCATGCATCACAC No data
Right 1056900790 9:90597458-90597480 CCCATCAGGTGCCGCGTCATGGG No data
1056900786_1056900790 -3 Left 1056900786 9:90597438-90597460 CCTGCTTGTCATGCATCACACCC No data
Right 1056900790 9:90597458-90597480 CCCATCAGGTGCCGCGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056900790 Original CRISPR CCCATCAGGTGCCGCGTCAT GGG Intergenic
No off target data available for this crispr