ID: 1056901143

View in Genome Browser
Species Human (GRCh38)
Location 9:90600478-90600500
Sequence GAGCCTTTGCTGATTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056901140_1056901143 -1 Left 1056901140 9:90600456-90600478 CCTCCAAGATAAAAAAAAGACCG No data
Right 1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG No data
1056901137_1056901143 23 Left 1056901137 9:90600432-90600454 CCCAACTTCTAGGTAAGCGTATG No data
Right 1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG No data
1056901141_1056901143 -4 Left 1056901141 9:90600459-90600481 CCAAGATAAAAAAAAGACCGAGC No data
Right 1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG No data
1056901136_1056901143 24 Left 1056901136 9:90600431-90600453 CCCCAACTTCTAGGTAAGCGTAT No data
Right 1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG No data
1056901138_1056901143 22 Left 1056901138 9:90600433-90600455 CCAACTTCTAGGTAAGCGTATGG No data
Right 1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056901143 Original CRISPR GAGCCTTTGCTGATTCTCCC TGG Intergenic
No off target data available for this crispr