ID: 1056902558

View in Genome Browser
Species Human (GRCh38)
Location 9:90613410-90613432
Sequence GAGCAGCGAGGCGGAGGCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056902558_1056902565 -5 Left 1056902558 9:90613410-90613432 CCAAGGCCTCCGCCTCGCTGCTC 0: 1
1: 0
2: 0
3: 34
4: 301
Right 1056902565 9:90613428-90613450 TGCTCTGCACCTCGCGGCTGGGG 0: 1
1: 0
2: 3
3: 8
4: 101
1056902558_1056902568 30 Left 1056902558 9:90613410-90613432 CCAAGGCCTCCGCCTCGCTGCTC 0: 1
1: 0
2: 0
3: 34
4: 301
Right 1056902568 9:90613463-90613485 TTGTTCCCCACCAGCATGATGGG 0: 1
1: 0
2: 2
3: 26
4: 132
1056902558_1056902567 29 Left 1056902558 9:90613410-90613432 CCAAGGCCTCCGCCTCGCTGCTC 0: 1
1: 0
2: 0
3: 34
4: 301
Right 1056902567 9:90613462-90613484 CTTGTTCCCCACCAGCATGATGG 0: 1
1: 0
2: 4
3: 25
4: 165
1056902558_1056902564 -6 Left 1056902558 9:90613410-90613432 CCAAGGCCTCCGCCTCGCTGCTC 0: 1
1: 0
2: 0
3: 34
4: 301
Right 1056902564 9:90613427-90613449 CTGCTCTGCACCTCGCGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1056902558_1056902563 -7 Left 1056902558 9:90613410-90613432 CCAAGGCCTCCGCCTCGCTGCTC 0: 1
1: 0
2: 0
3: 34
4: 301
Right 1056902563 9:90613426-90613448 GCTGCTCTGCACCTCGCGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056902558 Original CRISPR GAGCAGCGAGGCGGAGGCCT TGG (reversed) Exonic
900132409 1:1092649-1092671 CAGCAGGGAGACGGAGGCCCTGG + Intronic
900208723 1:1442734-1442756 GAGAAGCCAGACAGAGGCCTGGG + Exonic
900907160 1:5567281-5567303 GAGCAGTGAGGCTGATGCCCAGG + Intergenic
901022106 1:6260839-6260861 GAGCAGCGAGCCGGAGCCCCGGG - Exonic
901513572 1:9730579-9730601 GAGCAGCGAGGAGGAGGAGGGGG - Exonic
901919929 1:12528604-12528626 GAGCAGCCCGGCAGAGACCTTGG + Intergenic
902662784 1:17916964-17916986 GAGCAGACAGAGGGAGGCCTTGG - Intergenic
903214969 1:21838832-21838854 GAGCAGCTGGGCAAAGGCCTCGG + Exonic
904199790 1:28812293-28812315 GAGCGGCAAGGCAGAGGCCGCGG - Exonic
904771784 1:32885006-32885028 GAGCCTGGAGGCGGAGCCCTGGG + Intergenic
905463073 1:38134004-38134026 GAGGAGGGAGGCGGCGGCCGGGG + Intergenic
906353769 1:45085247-45085269 GAGCAGGGTAGCGGAGCCCTGGG + Intronic
908476052 1:64489791-64489813 GAGCAGCCAGGAAGAGTCCTGGG + Intronic
909352670 1:74673378-74673400 GGGGAGCGAGGGGGAGGGCTGGG - Intronic
912495442 1:110088688-110088710 GAGCAGAGAGGCCTTGGCCTTGG - Intergenic
912929118 1:113940596-113940618 GAGCTGGGAGGAGGAGGCCCTGG - Exonic
913254941 1:116944769-116944791 CAGCGGCGAGGCGGAGGCGGCGG - Exonic
915733785 1:158071986-158072008 GAGCAGTGAGGTGCAGGCCTCGG - Intronic
915733948 1:158072830-158072852 GAGCAGTGAGGTGCAGGCCTCGG + Intronic
915740208 1:158113494-158113516 GAGCAGCGCGGAGGAGGCCGCGG - Intergenic
918096584 1:181341195-181341217 GAGCAGCAAGGCCAAGGCTTTGG - Intergenic
918097807 1:181349101-181349123 GAGCAGGGAGGGGGCGGGCTTGG + Intergenic
919741370 1:200983330-200983352 GAGGAGCGAGGAGGGGGCCACGG + Intronic
920049370 1:203154052-203154074 GAGCAGGGAGGTGGAGGGCCGGG - Intronic
920369664 1:205470239-205470261 GGGCAGGGAGGCGGAGCCTTGGG + Intergenic
922566878 1:226606816-226606838 GAGCAGCCAGGTAGTGGCCTCGG + Exonic
1062818969 10:519822-519844 GAGGAGCAGGGGGGAGGCCTGGG - Intronic
1062911673 10:1215983-1216005 GAGCAACGTGGGGGAGGCCTCGG + Intronic
1063939314 10:11110590-11110612 GAGAAGAGAGGAGGAGGCCTGGG + Intronic
1064144398 10:12816027-12816049 CAGCAGTGAGGAGGTGGCCTGGG - Intronic
1065102652 10:22345865-22345887 GGGCAGCGGGGCGGAGGCGTCGG - Intronic
1065855112 10:29823724-29823746 GAAAAGCGAGGCACAGGCCTCGG + Intergenic
1066406993 10:35127406-35127428 GGGCGGCGAGCCGGCGGCCTCGG - Intronic
1067696936 10:48542555-48542577 GAGAGGCGGGGCAGAGGCCTGGG - Intronic
1067831062 10:49611255-49611277 GAACAGCGTGGCGTAGTCCTCGG - Exonic
1068396266 10:56465925-56465947 GTGCAGCCAGGCAGAGGCCCTGG - Intergenic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1070392900 10:75986720-75986742 GAGAAGCGTGGCCTAGGCCTGGG - Intronic
1071598111 10:86942623-86942645 GTGCTGCGAGGCCGAGGCCGGGG - Exonic
1072527123 10:96282425-96282447 GAGCACTGATGAGGAGGCCTGGG - Intergenic
1072536226 10:96365634-96365656 AAGCACCAAGGCAGAGGCCTGGG + Exonic
1072615751 10:97048055-97048077 GAGCAGTGGGGCTGGGGCCTGGG - Intronic
1073099658 10:100999937-100999959 GAGCAGCGCGGCGGAGGTGAGGG + Exonic
1073464780 10:103688182-103688204 GAGCAGAGAGCGGGAGGCTTTGG - Intronic
1075788012 10:125063054-125063076 CAGCAGCGAGGCAGGGCCCTGGG + Intronic
1076688717 10:132209829-132209851 GTGCAGGGAGTCGCAGGCCTCGG + Intronic
1076818607 10:132926953-132926975 AAGCAGCCTGGCTGAGGCCTGGG - Intronic
1076861981 10:133142034-133142056 GCTCAGTGAGGCTGAGGCCTGGG - Intergenic
1077018121 11:405964-405986 GAGCAGCGAAGTGGACGTCTCGG - Exonic
1077100008 11:818523-818545 GAGCAAAGAGGCTGAGGACTGGG + Intergenic
1077141872 11:1028305-1028327 AAACAGCGAGGCGGTGCCCTCGG + Exonic
1077606914 11:3618480-3618502 CAGCAGAGAAGCTGAGGCCTGGG + Intergenic
1077852297 11:6085095-6085117 GAGCAACCAGGCAGGGGCCTTGG + Intergenic
1080387617 11:31819097-31819119 AAGCAGGGAGGGGGACGCCTGGG + Intronic
1081669092 11:44933393-44933415 GGGAAGCGAGTCTGAGGCCTGGG + Exonic
1081927908 11:46846055-46846077 GCGAAGCGAGCCGGAGGCCGGGG - Intronic
1082023355 11:47553046-47553068 CAGCAGCGAGGCGGCGGCGGCGG - Intronic
1083253211 11:61481655-61481677 GGGCAGAGAGACAGAGGCCTGGG + Intronic
1083256407 11:61498775-61498797 GAGCAGCGGTGGGGAGGCCTGGG - Intergenic
1083741689 11:64714601-64714623 AAGCAGTGAGGCTGGGGCCTGGG - Intronic
1083846074 11:65334259-65334281 GAGGAGCGGGGCCGAGGCCCGGG + Intronic
1084172131 11:67405811-67405833 GCCCAGGGAGGCTGAGGCCTGGG + Intronic
1084674863 11:70628423-70628445 GAGCAGGGAAACCGAGGCCTGGG - Intronic
1085645267 11:78218522-78218544 GAGCAGCAAGGAGCAGGGCTTGG - Exonic
1086110590 11:83194220-83194242 GACCACTGAGGCGGAGGCCTCGG - Intronic
1086895665 11:92309289-92309311 GAGAAGTGAGGGGGAGGGCTGGG - Intergenic
1090931359 11:131300618-131300640 GAGCACAGAGACTGAGGCCTTGG - Intergenic
1092137994 12:6163019-6163041 GAGCAGCCAGGACCAGGCCTGGG + Intergenic
1094296679 12:28914777-28914799 GAGCAGCCAGGCAAGGGCCTTGG - Intergenic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1096617893 12:52844576-52844598 GAGCAGCAAGGCTGAGGCTGAGG - Exonic
1097917913 12:65039577-65039599 GGGCAGCCAGGCAGGGGCCTTGG + Intergenic
1100391237 12:94148101-94148123 GAGCGGCGAGAGGGAGGCCCCGG - Intergenic
1102785266 12:115599507-115599529 GCGGAGCCAGGAGGAGGCCTGGG - Intergenic
1103699596 12:122842025-122842047 AAGCAGCGAGGCGGACAGCTGGG - Intronic
1107309638 13:39062786-39062808 GAGCAGCCAGCCGGAAGACTTGG + Intergenic
1108478427 13:50843429-50843451 GAGGAGCGGGGCGGGGGCGTGGG - Exonic
1108484372 13:50909798-50909820 GAGCCGCGAGGGAGAGGCCGCGG + Exonic
1112119422 13:96393307-96393329 GAGCAGCCCGGAGGAGACCTAGG + Intronic
1113517616 13:110915223-110915245 GAGCAGCCGGGCGGAGGGCGGGG + Intergenic
1113773346 13:112926773-112926795 GAGCAGAGTGGCGGTCGCCTGGG + Intronic
1113924017 13:113930368-113930390 GAGCACCGAGGCGGGGGCGCAGG + Intergenic
1113924024 13:113930390-113930412 GAGCACCGAGGCGGGGGCGCAGG + Intergenic
1113924032 13:113930412-113930434 GAGCACCGAGGCGGGGGCGCGGG + Intergenic
1115027310 14:28760130-28760152 GAGCAGCGGCGCGCAGACCTGGG + Intergenic
1115850263 14:37584842-37584864 GCGCAGCGCGGCGGAGCTCTCGG + Intergenic
1118885554 14:69863029-69863051 GAGCAGAGGGGCTGAGGCCAAGG + Intronic
1119383071 14:74240777-74240799 GAGGAGCGGAGCGGAGGCGTGGG - Intronic
1120012970 14:79437999-79438021 GAGAAGCCACGCTGAGGCCTGGG - Intronic
1121013613 14:90535438-90535460 CAGCAGGGAGGCAGAGGCCTGGG - Exonic
1121020128 14:90574995-90575017 GAGCGGCGAGGGGGAGGCCAGGG - Intronic
1121117686 14:91355154-91355176 GAGCAGCCAGGCGGAAGCAGGGG + Intronic
1122093102 14:99352913-99352935 GAACAGTGGGGAGGAGGCCTGGG + Intergenic
1122198132 14:100105046-100105068 GAGCAGCAAGGAGGTGGCCCTGG - Intronic
1122445135 14:101762130-101762152 GAGCCGCGGGGCGCAGGCCCGGG + Intronic
1123083783 14:105708186-105708208 GAGGGGCGAGGCGGGGGCATGGG - Intergenic
1202929082 14_KI270725v1_random:23099-23121 GCGCAGAGAGGCGCAGGCCCAGG - Intergenic
1123722194 15:23069405-23069427 AACCTGGGAGGCGGAGGCCTAGG - Intergenic
1124606501 15:31173341-31173363 CAGCAGCGGGGGAGAGGCCTGGG - Intergenic
1126489974 15:49225945-49225967 GAGCAGCTGGGCAGAGGCCTTGG + Intronic
1126823545 15:52528531-52528553 GAGCAGCGCGGCAGGGGCCTGGG + Intronic
1128224037 15:65989357-65989379 GAGAAGGGAGGTGGGGGCCTTGG - Intronic
1129737723 15:77975305-77975327 GAGCATGGAGGCGGGGGCCCTGG - Intergenic
1130788182 15:87123338-87123360 GAGCAACGAGGGGGAGGCAAAGG - Intergenic
1132554121 16:565172-565194 GGGCTGCGAGGGGGAGCCCTGGG - Exonic
1133340081 16:5030373-5030395 GAGCAGCGTGGGTGAGTCCTGGG - Exonic
1134521851 16:14922422-14922444 GAGCACCGAGGCTGAGCCGTTGG - Intronic
1134709521 16:16321073-16321095 GAGCACCGAGGCTGAGCCGTTGG - Intergenic
1134716734 16:16361102-16361124 GAGCACCGAGGCTGAGCCGTTGG - Intergenic
1134950082 16:18347572-18347594 GAGCACCGAGGCTGAGCCGTTGG + Intergenic
1134958016 16:18391057-18391079 GAGCACCGAGGCTGAGCCGTTGG + Intergenic
1136580816 16:31149835-31149857 GAGGAGGGAGAGGGAGGCCTGGG - Intronic
1136613646 16:31382174-31382196 GAGAAGGGAGACTGAGGCCTGGG - Intronic
1136990939 16:35151088-35151110 CAGCAGGGAGGCTGAGACCTGGG - Intergenic
1137287758 16:47030541-47030563 GAGCAGCCTGGTGTAGGCCTTGG + Intergenic
1137323548 16:47410967-47410989 GAGCTGCCAGGCAGGGGCCTTGG - Intronic
1138527277 16:57616381-57616403 GAGCAGAGAGGCTGAGCCCGCGG + Intronic
1139549206 16:67664087-67664109 GAGCAGGCAGGCTGAGGTCTGGG + Intronic
1140456926 16:75111146-75111168 GAGGAGAGGGGCGGAGGCCAGGG + Intergenic
1140692803 16:77500394-77500416 TATCAGGGAGGCGGAGGGCTTGG + Intergenic
1140808407 16:78554186-78554208 GAGCAGGGATGGGGAGGACTTGG + Intronic
1141470464 16:84234877-84234899 GAGCAGGGAGGCTGAGGACGGGG - Intronic
1141537469 16:84692441-84692463 GAGCAGGAAGGCAGAGGGCTGGG - Intergenic
1141548457 16:84787993-84788015 GAGCAGGGAGGTGGAGGGCGTGG + Intergenic
1142116252 16:88357572-88357594 TAGCAGGCAGGCGGGGGCCTGGG + Intergenic
1142577169 17:917217-917239 AACCCGCGAGGCGGAGGCCACGG - Intronic
1142594115 17:1021276-1021298 CAGGAAGGAGGCGGAGGCCTGGG - Intronic
1142763952 17:2055747-2055769 GAGCTGCGAGCCGAGGGCCTGGG + Intronic
1143583285 17:7838615-7838637 GAGGAGTGAGGGGGAAGCCTAGG - Intergenic
1144576761 17:16434533-16434555 GAGCAGAGAGACGGAGTCTTGGG + Intronic
1144614138 17:16752689-16752711 GAGTAGCTAGGCAGGGGCCTTGG + Intronic
1144898572 17:18562978-18563000 GAGTAGCTAGGCAGGGGCCTTGG - Intergenic
1145133804 17:20382741-20382763 GAGTAGCTAGGCAGGGGCCTTGG + Intergenic
1146172934 17:30646836-30646858 GCGCGGCGAGGCAGAGGCCATGG + Intergenic
1146346391 17:32062826-32062848 GCGCGGCGAGGCAGAGGCCATGG + Intergenic
1147891519 17:43720757-43720779 CAGCACGGAGGCGGAGGCCCAGG - Intergenic
1148437927 17:47696641-47696663 GCACAGCCAGGCTGAGGCCTGGG + Intronic
1148739492 17:49884507-49884529 GAGCTGGGATGGGGAGGCCTAGG + Intergenic
1148788916 17:50162079-50162101 CAGGAGTGAGGCGGAGGCCGGGG + Intergenic
1149426297 17:56557857-56557879 GAGCAGCGTGGTGCTGGCCTTGG - Intergenic
1150294697 17:64001554-64001576 GGGCAGCGGGGCCCAGGCCTGGG + Intronic
1151557582 17:74854411-74854433 AAGCAGAGAGGAGGAGGGCTGGG + Intronic
1152362690 17:79839795-79839817 GTGCCGCGAGGGGGAGGCCCGGG - Intergenic
1152628616 17:81399681-81399703 GAGCAGCGCGGCCGGGGCCCGGG - Exonic
1155143707 18:23066344-23066366 GAGGAACGAGGAGGAGGACTTGG - Intergenic
1155517417 18:26637427-26637449 GAGCTGCGAGGAGGAGGCGCTGG + Intronic
1157473731 18:48008422-48008444 CAGCTGCGAGGCGGGGGCCGGGG - Intergenic
1158395828 18:57077830-57077852 CAGCAGAGAGGCAGAGGCCTTGG - Intergenic
1160695967 19:484705-484727 GAGGAGCGAGGAGGAGGCCAGGG + Intergenic
1160703403 19:518471-518493 GGGCTGAGAGGAGGAGGCCTGGG + Intronic
1160793376 19:933103-933125 GGGCAGAGAGGCCGGGGCCTTGG + Intronic
1160797787 19:953732-953754 GAACAGCGCCGCGGAGGCCCTGG + Intronic
1161076563 19:2288611-2288633 GCGGAGGGAGGCGGAGGGCTGGG + Intronic
1161154898 19:2727462-2727484 GAGCATCGAGGTGAAGGCCGAGG + Intronic
1161196851 19:2991645-2991667 GAGAAGGGAGGCTGAGGGCTGGG + Intronic
1161399690 19:4061732-4061754 GGGCAGCGATGAGGAGGCCAGGG + Intronic
1161853798 19:6752787-6752809 GAGGGGCGAGGCGGGCGCCTGGG - Intronic
1162042214 19:7977827-7977849 GAGGAGCGGGGCAGAGGCTTGGG + Intronic
1162460093 19:10809817-10809839 GAGCAGCGAGGCCCTGGCATAGG - Intronic
1163158865 19:15453194-15453216 AGGCAGCGAGGCGGAGTCCCGGG + Exonic
1163592913 19:18204384-18204406 GGGCCGAGAGGCTGAGGCCTTGG + Intergenic
1163613328 19:18312015-18312037 GAGCACTGAGGAGGAGGCCAGGG - Intronic
1164483870 19:28637963-28637985 GAGAAGCAAGGCAGAAGCCTGGG - Intergenic
1165561963 19:36687699-36687721 GAGGAGGGAGGCGGGAGCCTGGG + Intronic
1165853992 19:38869298-38869320 GTGCAGGGAGGCGCGGGCCTCGG + Exonic
1165935500 19:39386251-39386273 GAGCAGCGAGGATGAGGCCCGGG - Exonic
1166329559 19:42070151-42070173 GGGCAGGCAGGCGGCGGCCTCGG - Intronic
1166851600 19:45764028-45764050 CAGCAGCGAGGCTGAGGACTGGG + Exonic
1167575513 19:50315708-50315730 GGGCGGTGAGGCGGAGGGCTGGG + Exonic
1168144908 19:54415515-54415537 GGGCAGCGGGGCGGACGCCGGGG - Exonic
1168330216 19:55563796-55563818 GAGCAGTGAGGGGGAGGCAGAGG - Intergenic
925169603 2:1743169-1743191 GAGCCGCGGGGCGGAGGGATGGG + Intronic
926349765 2:11984175-11984197 GAGCTGCCAGGCGGAGACCCCGG + Intergenic
927504603 2:23604794-23604816 GAGCAGGGAGGAGGAGGCACTGG - Intronic
927514336 2:23663115-23663137 GAGCAGCGAGGAGCAGGGCGCGG - Intronic
927836345 2:26402103-26402125 GCGCAGCGATGCGGAGGCGCCGG - Exonic
927936283 2:27078578-27078600 CAGCAGGGAGGAGGAGGCCAGGG + Exonic
929075714 2:38077195-38077217 GGCCAGCGAGGCGGACGCTTGGG + Intronic
929107233 2:38377115-38377137 GGCCAGCGAGGCAGAGGCCGCGG - Intronic
929108512 2:38386937-38386959 TAGCAGCGGGGAGGAGGCCTGGG - Intergenic
929242295 2:39665730-39665752 GAGCGGCGCGGGGGAGGGCTAGG + Intronic
931241153 2:60453535-60453557 GAGCAGAGCAGCGGAGACCTGGG + Intronic
932580704 2:72991171-72991193 GACCAGGGAGGGGGAGGCTTTGG - Intronic
932774845 2:74522080-74522102 GAGCAGCGTTACAGAGGCCTAGG + Intronic
935149066 2:100417510-100417532 GGGCCGCGGCGCGGAGGCCTCGG - Exonic
938066281 2:128283653-128283675 GAGGAGCGAGGGGGAGGCCGAGG - Intronic
938115786 2:128602250-128602272 CAGCAGCGAGGCTGAGGCCCAGG + Intergenic
946179145 2:217939663-217939685 GACCAGCAAGGCGGGGGCCTGGG - Intronic
947490930 2:230593887-230593909 GAGCAGTGAGGCAGCGGCCCCGG - Intergenic
947872803 2:233449158-233449180 GGGCAGAGAGGACGAGGCCTGGG - Exonic
948494406 2:238337574-238337596 GCGCAGCGAGGAGGGGGCCATGG + Intronic
948577836 2:238965614-238965636 GAGCAGGGAGGGGGAGGCAGAGG - Intergenic
1169500726 20:6158066-6158088 GAGCAGCCAGGCAGGGGCCTTGG + Intergenic
1172578962 20:36031623-36031645 GAGGAGCCTGGCGGAGGCCATGG + Intergenic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174317484 20:49713824-49713846 GAGCGGCGAGGCGGCGGCGGCGG - Exonic
1175575300 20:60056468-60056490 GAGCTGGGAGCAGGAGGCCTGGG + Intronic
1175927111 20:62476291-62476313 GGGCAGGGAGGCAGAGGGCTCGG - Intergenic
1176548481 21:8211930-8211952 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176556375 21:8256138-8256160 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176567412 21:8394965-8394987 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1176575314 21:8439180-8439202 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1178845327 21:36169689-36169711 GGGCAGCGAGGCGGGTGACTTGG + Intronic
1179839020 21:44058339-44058361 GAGCAGCGGTGAGGAGGCCTTGG + Intronic
1181001098 22:19988092-19988114 GAGAAGCCAGTGGGAGGCCTGGG - Intronic
1181271025 22:21658441-21658463 GTGCAGCCAGGCCGAGGGCTAGG + Intronic
1181807935 22:25386235-25386257 GAGTAGCCAGGCAGAGCCCTGGG - Intronic
1181959946 22:26615894-26615916 GAGGAGGGAGGAGGAGGCCAAGG + Intronic
1181967978 22:26669820-26669842 GTGCAGGGAGGCGGAGGCCCTGG + Intergenic
1182771833 22:32801863-32801885 GGGCAGCGCGCCGGAGGCCAAGG + Exonic
1183213566 22:36465472-36465494 GAGAAGTGTGGCAGAGGCCTTGG - Intergenic
1183688436 22:39375134-39375156 GAACAGCGAGGCTGAAGCCTCGG - Intronic
1184019263 22:41809564-41809586 GAGCAGAGAGGTGGAGGCTCTGG + Intronic
1184110574 22:42391603-42391625 GAGCAGCGATGAGGAGACGTGGG + Intronic
1184418515 22:44365695-44365717 GAGCTGGGAGCAGGAGGCCTGGG + Exonic
1185029519 22:48434341-48434363 GGGCAGGGAGGCGGAGCCCCGGG + Intergenic
1203253365 22_KI270733v1_random:128235-128257 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1203261419 22_KI270733v1_random:173313-173335 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
949129389 3:482873-482895 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129409 3:482962-482984 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129429 3:483051-483073 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129450 3:483140-483162 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129470 3:483229-483251 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129491 3:483318-483340 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129512 3:483407-483429 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
949129533 3:483496-483518 GAGCGGCGAGGCTGAGGCGCGGG + Intergenic
950449043 3:13055274-13055296 GGGTAGCGAGGCGGAAGCCCTGG + Intronic
950525529 3:13520725-13520747 GAGCGGGGAGACAGAGGCCTAGG - Intergenic
950666603 3:14499287-14499309 GCGCAGCAAGGCGGGTGCCTGGG + Intronic
950687523 3:14629108-14629130 CAGCAGCGAGAAGAAGGCCTCGG + Intergenic
960955469 3:123027754-123027776 GAGCAGGGAGGAGGAGACCGCGG + Intronic
961779457 3:129313248-129313270 GGTCAGCAAGGTGGAGGCCTTGG + Intergenic
962233580 3:133688187-133688209 GAGCAGCCAGGCACAGCCCTAGG - Intergenic
962583718 3:136820122-136820144 GAGGAGCGAGGCGGAAAGCTCGG + Intronic
962978931 3:140470467-140470489 GAGCAGTGAGCAGGAGGGCTGGG + Intronic
965913615 3:173814020-173814042 AAGCGGCGAGGCCGAGGGCTAGG + Intronic
968657409 4:1784688-1784710 GCACAGCAAGGCGGCGGCCTTGG + Intergenic
968954353 4:3710656-3710678 GAGCAGAGAGGCTGTGGCCATGG - Intergenic
969361204 4:6664801-6664823 GCGCAGGGAGCGGGAGGCCTGGG - Intergenic
969604941 4:8197718-8197740 GGGCAGCGAGGGGCATGCCTAGG + Intronic
969717404 4:8874429-8874451 GAGCACAGAGGCAGTGGCCTGGG - Intergenic
976992326 4:91382413-91382435 CAGCAGCGAGGCTGAGGGCCAGG - Intronic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
982782615 4:159507012-159507034 GAGGAGCGAGGAGGAGGCACAGG - Intergenic
984638986 4:182143224-182143246 GTGATGCGGGGCGGAGGCCTAGG + Intergenic
985148446 4:186919548-186919570 GTGCAGCGCGGGGCAGGCCTGGG - Intergenic
986340612 5:6786183-6786205 GAGCAGTGAGACGGATGCTTTGG + Intergenic
987086492 5:14474391-14474413 CAGCAGGGAGGCCGAGGGCTCGG - Intronic
990309015 5:54519689-54519711 GAGCAGAGACGTGGACGCCTGGG + Exonic
992086727 5:73284341-73284363 GAGCAGAGAAGGGGAGGGCTTGG + Intergenic
993905798 5:93621499-93621521 GCCCGGAGAGGCGGAGGCCTCGG - Intronic
997225315 5:132205299-132205321 GAGCAGCAATCCAGAGGCCTGGG + Intronic
997745399 5:136295570-136295592 TAGCAGCCTGGAGGAGGCCTGGG - Intronic
998004151 5:138646277-138646299 GAGCAGGGAGGCAGGGGCTTTGG - Intronic
1000859325 5:166437840-166437862 GAGCAGGGTGGAGGAGGACTGGG - Intergenic
1001517780 5:172367885-172367907 GAGCAGCAAGATGGGGGCCTGGG + Intronic
1001644721 5:173271530-173271552 CAGCAGCAAGGCCGAGGCCCAGG + Intergenic
1002001786 5:176200144-176200166 GAGCAGGGAGGCAAAGGCGTTGG + Intergenic
1002252550 5:177938826-177938848 GAGCAGGGAGGCAAAGGCGTTGG - Intergenic
1002428337 5:179188708-179188730 GAGGAGTGAGGGGGTGGCCTTGG - Intronic
1003508553 6:6760087-6760109 GAGCAGTGAGGAGGAGGGCAAGG - Intergenic
1004202048 6:13558013-13558035 GAGCAGCCAGGAGGGGGCCTGGG - Intergenic
1005360460 6:25026820-25026842 GAGCTAAGAGGCTGAGGCCTGGG + Intronic
1006026621 6:31151056-31151078 GACCAGCAAGGCTGAGGGCTTGG - Exonic
1006514153 6:34536737-34536759 GCCCAGCGAGGCACAGGCCTGGG + Intergenic
1006796313 6:36734598-36734620 GAGCTGAGACGGGGAGGCCTGGG - Intergenic
1007715093 6:43851201-43851223 CCCCAGCGAGGCGGAGGCGTGGG - Intergenic
1010430818 6:75776537-75776559 GAGCAACCAGGTGGTGGCCTAGG - Intronic
1018392310 6:163349912-163349934 TAGGAGCCAGGCGGAGGCCTGGG - Intergenic
1018844901 6:167548801-167548823 GAGCAGACAGGCAGTGGCCTGGG - Intergenic
1019343371 7:518699-518721 GAGCAGCGAGGTGGACGAGTGGG - Intronic
1019603289 7:1895909-1895931 GGGCAGTGAGGGGGCGGCCTGGG + Intronic
1019648558 7:2143939-2143961 CAGCATCGAGGAGGATGCCTGGG + Intronic
1019723442 7:2587284-2587306 GGGGTGCGAGGCAGAGGCCTGGG + Intronic
1020069252 7:5214905-5214927 GAGCAGTGTGGCAGAGGCCCGGG - Intronic
1020260258 7:6526929-6526951 GAGCAGCGAGGGGGAGACTGGGG - Intronic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1022208369 7:28184405-28184427 GAGCAGCCAGGTGGAGAGCTAGG - Intergenic
1024310337 7:47963214-47963236 GAGCAAAGAGGTGGAGGACTTGG + Intronic
1024499815 7:50093126-50093148 GAGCAGGGAGCCGGCGGCCCGGG + Exonic
1029112849 7:98222504-98222526 GTGCAGCCAGGAGGAGCCCTGGG + Exonic
1030121112 7:106111973-106111995 GGGCAGGGAGGCCGCGGCCTGGG - Intronic
1032536957 7:132672387-132672409 GAGCAGCGGGGCGGAGATGTGGG + Intronic
1032768484 7:135023773-135023795 GAGCAGCTAGGCAGGGGCCTTGG - Intronic
1033523134 7:142182341-142182363 GAGCAGCCAAGCAGTGGCCTTGG + Intronic
1034263819 7:149772291-149772313 GGGAAGGGAGGCGGGGGCCTCGG - Intronic
1037163388 8:15798571-15798593 GAGCAGCGTGGCGGCAGCTTTGG + Intergenic
1037769884 8:21792242-21792264 GAGCAGTGTGGCCCAGGCCTAGG - Intronic
1037906381 8:22718263-22718285 CAGAAGGGAGGAGGAGGCCTAGG - Intronic
1038515459 8:28183896-28183918 GAGCAGTTAGGCTGAGGGCTCGG + Intronic
1039526913 8:38225282-38225304 CAGCATAGTGGCGGAGGCCTCGG - Intronic
1039542293 8:38382205-38382227 CAGCACGGAGGCGGAGGCCGAGG - Exonic
1042944809 8:74144481-74144503 GAGCAGGAAGGCAGAGGCCAGGG + Intergenic
1045248139 8:100460907-100460929 CAGCAGTGAAGCTGAGGCCTTGG + Intergenic
1047081956 8:121472265-121472287 GCGCAGCCAGGCAGAGGCCGAGG + Intergenic
1048329987 8:133464745-133464767 GAGCAGCGAGGCGGGGCCACAGG + Intronic
1049001944 8:139831856-139831878 GAGCACGGAGGCAGAGGCCTGGG - Intronic
1049006389 8:139858367-139858389 CAGCAGCTGGGCGGAGGCCCCGG - Intronic
1049537849 8:143190211-143190233 GAGGAGGGAGGCGGGGACCTGGG - Intergenic
1050533415 9:6609817-6609839 AAGCAGCCAAGCGCAGGCCTGGG - Intronic
1051708363 9:19904292-19904314 GAGGAGAGAGGCAGAGGCCTTGG - Intergenic
1056902558 9:90613410-90613432 GAGCAGCGAGGCGGAGGCCTTGG - Exonic
1057142473 9:92735648-92735670 GGGCAGGGAGGGGCAGGCCTGGG + Intronic
1057694497 9:97313663-97313685 GAGCAGGGAGGCCGAAGGCTAGG - Intronic
1058714065 9:107707588-107707610 TAGCAACGAGGAGGAGACCTGGG - Intergenic
1060103224 9:120857770-120857792 CAGCAGAGAGACGCAGGCCTTGG + Exonic
1060191756 9:121598427-121598449 GACCACGGAGGCGGAGGCCGCGG + Intronic
1060818653 9:126649180-126649202 GAGGAGGGATGGGGAGGCCTGGG - Intronic
1061036201 9:128115623-128115645 GAGCTGAGAGCAGGAGGCCTAGG - Intergenic
1061090689 9:128424329-128424351 GAGCAGAGAGCCTGAGGCCTTGG + Intronic
1061578849 9:131524381-131524403 GAGAAGCGAGGCGGATGCCCTGG - Exonic
1061818368 9:133209079-133209101 GAGGAGCCAGGCGGACTCCTGGG - Intronic
1061898087 9:133658838-133658860 GAGCAGCGGGGCGGGGGCGGGGG - Exonic
1062022489 9:134326138-134326160 GAGCCGCGAGGAGGCGGCGTGGG - Intronic
1062062512 9:134504014-134504036 GATCAGCCAGGGTGAGGCCTGGG - Intergenic
1062082910 9:134633911-134633933 GAACAGGGAGGAGGTGGCCTGGG - Intergenic
1062209487 9:135356030-135356052 GAGCAGCGAGGGGGTGGGCCGGG - Intergenic
1062306739 9:135911609-135911631 GAGCAGCGAGACAGAGGCATGGG + Intergenic
1062427718 9:136513575-136513597 GAGCAGCACGGCCGGGGCCTGGG + Intronic
1062491514 9:136807337-136807359 GAGGAGCGCGGTGAAGGCCTGGG + Intronic
1062585443 9:137247438-137247460 CAGCAGGGAGGGTGAGGCCTGGG + Intronic
1062595843 9:137298810-137298832 GAGTAGGAAGGCGGAGGCGTGGG + Intergenic
1062653298 9:137589643-137589665 GAGCAGAGAGGAAGAAGCCTGGG - Intronic
1062675737 9:137742628-137742650 CAGCAGCGAGGAAGGGGCCTGGG - Intronic
1203469765 Un_GL000220v1:111382-111404 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1203477586 Un_GL000220v1:155354-155376 GAGCGGCGCGGCGGAGGCGACGG - Intergenic
1203621120 Un_KI270749v1:130410-130432 GCGCAGAGAGGCGCAGGCCCAGG - Intergenic
1185465549 X:352394-352416 GAGCCACGGGGAGGAGGCCTGGG - Intronic
1191250226 X:58256654-58256676 AAGCGGCAAGGCGGAGGGCTAGG + Intergenic
1191250748 X:58259067-58259089 AAGCAGTGAGGCTGAGGGCTAGG + Intergenic
1191251617 X:58262672-58262694 AAGCGGCGAGGCCGAGGGCTAGG + Intergenic
1191251756 X:58263259-58263281 GAGCAACGAGGCAGAGGGCTAGG + Intergenic
1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG + Intergenic
1191252503 X:58266266-58266288 AAGCGGCGAGGCTGAGGGCTAGG - Intergenic
1196786693 X:119427165-119427187 GAGCAGAGCTGCTGAGGCCTGGG - Intronic
1198750291 X:139932143-139932165 GAGCAGCGAGGCGGGCGGCCGGG + Intronic