ID: 1056908732

View in Genome Browser
Species Human (GRCh38)
Location 9:90678245-90678267
Sequence CCCCTATGGCATTACAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056908728_1056908732 8 Left 1056908728 9:90678214-90678236 CCTGAGAAAAATAGGAAGAGGCT No data
Right 1056908732 9:90678245-90678267 CCCCTATGGCATTACAGTCCAGG No data
1056908725_1056908732 20 Left 1056908725 9:90678202-90678224 CCTGATGCAATGCCTGAGAAAAA No data
Right 1056908732 9:90678245-90678267 CCCCTATGGCATTACAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056908732 Original CRISPR CCCCTATGGCATTACAGTCC AGG Intergenic