ID: 1056909521

View in Genome Browser
Species Human (GRCh38)
Location 9:90686015-90686037
Sequence ACCAGCCTGCAGTCCCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056909521_1056909523 0 Left 1056909521 9:90686015-90686037 CCTAATTGGGACTGCAGGCTGGT No data
Right 1056909523 9:90686038-90686060 GAGGAGTGCAGATCACCTCCTGG No data
1056909521_1056909526 26 Left 1056909521 9:90686015-90686037 CCTAATTGGGACTGCAGGCTGGT No data
Right 1056909526 9:90686064-90686086 CTCCTTTTCTTCTTGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056909521 Original CRISPR ACCAGCCTGCAGTCCCAATT AGG (reversed) Intergenic
No off target data available for this crispr