ID: 1056910711

View in Genome Browser
Species Human (GRCh38)
Location 9:90697739-90697761
Sequence TGACACTGTTCTCTCTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056910711_1056910713 -5 Left 1056910711 9:90697739-90697761 CCAGAAGAGAGAGAACAGTGTCA No data
Right 1056910713 9:90697757-90697779 TGTCATTGTGGAGCACACACTGG No data
1056910711_1056910714 18 Left 1056910711 9:90697739-90697761 CCAGAAGAGAGAGAACAGTGTCA No data
Right 1056910714 9:90697780-90697802 TATAAAGATGCCAAATTCTAAGG No data
1056910711_1056910715 19 Left 1056910711 9:90697739-90697761 CCAGAAGAGAGAGAACAGTGTCA No data
Right 1056910715 9:90697781-90697803 ATAAAGATGCCAAATTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056910711 Original CRISPR TGACACTGTTCTCTCTCTTC TGG (reversed) Intergenic
No off target data available for this crispr