ID: 1056910713

View in Genome Browser
Species Human (GRCh38)
Location 9:90697757-90697779
Sequence TGTCATTGTGGAGCACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056910711_1056910713 -5 Left 1056910711 9:90697739-90697761 CCAGAAGAGAGAGAACAGTGTCA No data
Right 1056910713 9:90697757-90697779 TGTCATTGTGGAGCACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056910713 Original CRISPR TGTCATTGTGGAGCACACAC TGG Intergenic
No off target data available for this crispr