ID: 1056912098

View in Genome Browser
Species Human (GRCh38)
Location 9:90711022-90711044
Sequence AATATTTGCCAGAGGATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056912092_1056912098 28 Left 1056912092 9:90710971-90710993 CCATTCATATAATATTTTTGGTA No data
Right 1056912098 9:90711022-90711044 AATATTTGCCAGAGGATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056912098 Original CRISPR AATATTTGCCAGAGGATAGG GGG Intergenic
No off target data available for this crispr