ID: 1056913765

View in Genome Browser
Species Human (GRCh38)
Location 9:90727715-90727737
Sequence TCACCTTCTCCCAGTGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056913765_1056913769 22 Left 1056913765 9:90727715-90727737 CCTGCCGCACTGGGAGAAGGTGA No data
Right 1056913769 9:90727760-90727782 GCTGCATGACTGCATATTTAAGG No data
1056913765_1056913767 0 Left 1056913765 9:90727715-90727737 CCTGCCGCACTGGGAGAAGGTGA No data
Right 1056913767 9:90727738-90727760 ATCACTGCGCTGCCTTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056913765 Original CRISPR TCACCTTCTCCCAGTGCGGC AGG (reversed) Intergenic
No off target data available for this crispr