ID: 1056917682

View in Genome Browser
Species Human (GRCh38)
Location 9:90759229-90759251
Sequence GCTCGTTTACGACCCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056917682_1056917687 -10 Left 1056917682 9:90759229-90759251 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1056917687 9:90759242-90759264 GTAAACGAGCTGCCGAGGGAGGG No data
1056917682_1056917689 -6 Left 1056917682 9:90759229-90759251 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1056917689 9:90759246-90759268 ACGAGCTGCCGAGGGAGGGGTGG No data
1056917682_1056917688 -9 Left 1056917682 9:90759229-90759251 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1056917688 9:90759243-90759265 TAAACGAGCTGCCGAGGGAGGGG No data
1056917682_1056917690 -1 Left 1056917682 9:90759229-90759251 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1056917690 9:90759251-90759273 CTGCCGAGGGAGGGGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056917682 Original CRISPR GCTCGTTTACGACCCAAAAC GGG (reversed) Intergenic
No off target data available for this crispr