ID: 1056921076

View in Genome Browser
Species Human (GRCh38)
Location 9:90789652-90789674
Sequence GTGCCCTGCTAGTAGAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056921069_1056921076 7 Left 1056921069 9:90789622-90789644 CCACTCATAGAAGGCTACTGACC No data
Right 1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG No data
1056921067_1056921076 25 Left 1056921067 9:90789604-90789626 CCTTATAAGGCAGAAGTTCCACT No data
Right 1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG No data
1056921066_1056921076 26 Left 1056921066 9:90789603-90789625 CCCTTATAAGGCAGAAGTTCCAC No data
Right 1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056921076 Original CRISPR GTGCCCTGCTAGTAGAGTCA GGG Intergenic
No off target data available for this crispr