ID: 1056921179

View in Genome Browser
Species Human (GRCh38)
Location 9:90790541-90790563
Sequence TACGTGGGAGGCTGAGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056921179_1056921189 10 Left 1056921179 9:90790541-90790563 CCCCCGCCTCAGCCTCCCACGTA No data
Right 1056921189 9:90790574-90790596 CAGATGTGTGCCACCACACCTGG 0: 140
1: 2437
2: 13458
3: 46735
4: 114691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056921179 Original CRISPR TACGTGGGAGGCTGAGGCGG GGG (reversed) Intergenic
No off target data available for this crispr