ID: 1056923056

View in Genome Browser
Species Human (GRCh38)
Location 9:90809016-90809038
Sequence GTGCATATGCTTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056923051_1056923056 -1 Left 1056923051 9:90808994-90809016 CCCCTTCTCTGCATTTATAGCTG 0: 1
1: 0
2: 1
3: 15
4: 271
Right 1056923056 9:90809016-90809038 GTGCATATGCTTGAGGTGGAAGG No data
1056923052_1056923056 -2 Left 1056923052 9:90808995-90809017 CCCTTCTCTGCATTTATAGCTGT 0: 1
1: 0
2: 0
3: 26
4: 350
Right 1056923056 9:90809016-90809038 GTGCATATGCTTGAGGTGGAAGG No data
1056923053_1056923056 -3 Left 1056923053 9:90808996-90809018 CCTTCTCTGCATTTATAGCTGTG 0: 1
1: 0
2: 4
3: 15
4: 263
Right 1056923056 9:90809016-90809038 GTGCATATGCTTGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056923056 Original CRISPR GTGCATATGCTTGAGGTGGA AGG Intronic
No off target data available for this crispr