ID: 1056923577

View in Genome Browser
Species Human (GRCh38)
Location 9:90813462-90813484
Sequence CAACCACTCTGCCCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056923577_1056923584 23 Left 1056923577 9:90813462-90813484 CCTCTCTGGGGGCAGAGTGGTTG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1056923584 9:90813508-90813530 GTCTAGATTCCATCCTTCACTGG No data
1056923577_1056923581 1 Left 1056923577 9:90813462-90813484 CCTCTCTGGGGGCAGAGTGGTTG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1056923581 9:90813486-90813508 CAGAAGCAGACCAGGCCTCGGGG No data
1056923577_1056923579 -1 Left 1056923577 9:90813462-90813484 CCTCTCTGGGGGCAGAGTGGTTG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1056923579 9:90813484-90813506 GTCAGAAGCAGACCAGGCCTCGG No data
1056923577_1056923580 0 Left 1056923577 9:90813462-90813484 CCTCTCTGGGGGCAGAGTGGTTG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1056923580 9:90813485-90813507 TCAGAAGCAGACCAGGCCTCGGG No data
1056923577_1056923578 -7 Left 1056923577 9:90813462-90813484 CCTCTCTGGGGGCAGAGTGGTTG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 1056923578 9:90813478-90813500 GTGGTTGTCAGAAGCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056923577 Original CRISPR CAACCACTCTGCCCCCAGAG AGG (reversed) Intronic
900138336 1:1128232-1128254 GAGCCGCTCTGCACCCAGAGAGG + Intergenic
901465295 1:9417374-9417396 CAGCCACCCTGCCCCCATGGAGG - Intergenic
902194262 1:14786397-14786419 CATCCGCTCTTCCCCGAGAGTGG + Intronic
903389652 1:22954877-22954899 CAGCCCCACTGCTCCCAGAGTGG + Intronic
903919353 1:26788259-26788281 CATCCACGCTCACCCCAGAGGGG - Exonic
905869431 1:41394706-41394728 CCACCACCCTCTCCCCAGAGGGG - Intergenic
905997627 1:42395332-42395354 CAACCACTCTGTCCCCAAATAGG - Intronic
906153138 1:43599424-43599446 CATCCACTCTTCCCACAGAAAGG + Intronic
906662429 1:47592705-47592727 CATCCATTCGGCACCCAGAGTGG - Intergenic
906940249 1:50249345-50249367 CAACCACTGTTCCCCCAGTCTGG + Intergenic
909584063 1:77269910-77269932 CAACAACTCTGCCACCACACTGG - Intergenic
910461266 1:87450257-87450279 CAACCTTTCTGCACCGAGAGAGG + Intergenic
912795010 1:112688038-112688060 CACCTCCTCTGCCCCCAGACTGG + Intronic
915118057 1:153612666-153612688 CAAATACTCTGCCCCTGGAGAGG + Intronic
915244013 1:154543736-154543758 CAACCCCTACGCCCCCAGAATGG + Intronic
915245274 1:154551910-154551932 CAGCCACTCACCCTCCAGAGAGG + Exonic
915545183 1:156592957-156592979 CAGCCACTCCGGCCCCTGAGGGG - Intronic
915940546 1:160115844-160115866 CAGCCACTCTGCCCCAAGATGGG + Exonic
920316473 1:205079044-205079066 CTTCCACTTTGCCCCCAAAGGGG + Intergenic
920578807 1:207085340-207085362 CCACAACTCTTCCCCCAGATTGG + Intronic
920998500 1:211017953-211017975 CCACCCCACTTCCCCCAGAGAGG - Intronic
1062834142 10:624886-624908 CCACCCCTCTGTCCCCAGTGCGG - Intronic
1063133562 10:3197933-3197955 AAACCACACTGCCCCCAGCACGG + Intergenic
1065390405 10:25176067-25176089 GAACCACTCGGTCTCCAGAGTGG - Exonic
1066778915 10:38920580-38920602 CAACAATTCTGCCACCTGAGAGG - Intergenic
1069989579 10:72306616-72306638 CCACAATTCAGCCCCCAGAGAGG - Intergenic
1072842665 10:98792682-98792704 CCACCACTCTGACCCCTGGGTGG - Intronic
1073480470 10:103783396-103783418 CATCGACTCTGCCCCCACCGTGG - Intronic
1075408746 10:122211879-122211901 CCACCACTGTGACCGCAGAGAGG - Intronic
1076469205 10:130706960-130706982 GACCCTCTCTGCCCACAGAGGGG + Intergenic
1076747908 10:132523532-132523554 CACCCACTATGCCCCCAAATCGG + Intergenic
1076771944 10:132670560-132670582 CAACCACTCTCCCCCCAGCAAGG - Intronic
1076904060 10:133353555-133353577 CAAACCCTCAGCCCCCTGAGTGG - Intergenic
1078067917 11:8090049-8090071 CAACCTCTGTGCCTCCATAGCGG + Exonic
1078509661 11:11976030-11976052 CACCCACTCTACCCCTAGCGTGG + Intronic
1081722526 11:45300833-45300855 CCACCATCCAGCCCCCAGAGAGG - Intergenic
1084909090 11:72373111-72373133 CAAGCCCTCTACCCCCAGAAGGG + Intronic
1089494849 11:118902768-118902790 CGCCTGCTCTGCCCCCAGAGGGG - Exonic
1091271642 11:134317042-134317064 CAACAACATGGCCCCCAGAGTGG - Intronic
1095917720 12:47497289-47497311 AATCTACTCTGACCCCAGAGAGG + Intergenic
1100794282 12:98164112-98164134 CAACCACTCTAAAGCCAGAGGGG + Intergenic
1100883237 12:99041287-99041309 CATCCACTCTTCGCTCAGAGTGG - Intronic
1104925647 12:132312813-132312835 CCACGTCTCTGCCCCCAGGGTGG + Intronic
1113884518 13:113651685-113651707 CAACGGCTCGGCCCCCAGAGTGG - Exonic
1114152063 14:20052737-20052759 CAGCAAATCTGCCCCCAAAGTGG + Intergenic
1117989639 14:61420934-61420956 CACCCACTCTGGCCCTAGATAGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119543633 14:75456608-75456630 CAACCACTCAGCTCCAAGACGGG - Intronic
1121129243 14:91430186-91430208 CCACCACTGTACCACCAGAGGGG + Intergenic
1121765384 14:96481210-96481232 ATTCCACTCTGACCCCAGAGTGG - Intronic
1122337825 14:101005504-101005526 CAGCCACTCCGCCCTCTGAGTGG - Intergenic
1122552390 14:102557007-102557029 CAACCAGTCTGTCCCCTGAGGGG - Intergenic
1129107937 15:73322058-73322080 GCTCCACTCTGCCCCCAGAAAGG - Exonic
1129698962 15:77756790-77756812 CACCCACTCTGCCTCCCTAGAGG + Intronic
1130664975 15:85861860-85861882 CAACTCTTCTGCCTCCAGAGAGG - Intergenic
1131569061 15:93514877-93514899 TAACCACTATGGCCCCAAAGGGG + Intergenic
1132876994 16:2144366-2144388 CCTACACTCTGCCCCCAGAGTGG - Intronic
1132892924 16:2213331-2213353 CAGTCCCTCTGCCCCCTGAGGGG + Exonic
1132936335 16:2483165-2483187 CACCCACTCTACCCCAAGAAAGG - Intronic
1133507966 16:6430772-6430794 CATCCACACTGCAGCCAGAGTGG - Intronic
1134164756 16:11921025-11921047 CAGCCCCTCTGCCCACCGAGAGG + Intergenic
1136065340 16:27754684-27754706 CATCCACTCTGCCCCGGGGGTGG + Intronic
1136283462 16:29228070-29228092 CAAACACTCAGGCCCCAGCGTGG + Intergenic
1136671802 16:31865124-31865146 CAGCCACTCATCCCCCATAGAGG - Intergenic
1137546241 16:49405570-49405592 AAAGCACTCTGCACCCACAGAGG - Intergenic
1137556522 16:49473812-49473834 CAGCCACTCTGCCTCCAAGGTGG + Intergenic
1139375497 16:66494031-66494053 CACCCACTATACCCCCAGTGGGG + Intronic
1141698510 16:85631947-85631969 CAGCCACGCTGCCCCCAAGGCGG - Intronic
1141965114 16:87436961-87436983 CTTCCAGTCTGCCCCCAGTGTGG + Intronic
1142434810 16:90049470-90049492 CAACCAGACTGGCCCCAGTGGGG + Intergenic
1142862462 17:2771146-2771168 CTGCCACTCTCCCTCCAGAGAGG - Intergenic
1142961365 17:3554310-3554332 CATCCACTCTGCACCCAGCCGGG - Intronic
1147336084 17:39727612-39727634 CACTCCCTCTGCCCCCACAGTGG - Intronic
1149224561 17:54454200-54454222 CAACCAGTTTGCACACAGAGAGG - Intergenic
1149494541 17:57108945-57108967 CAAGCAGTCTTCCCCCAGAAGGG + Intronic
1149771940 17:59329514-59329536 CAACTTCTCTGAACCCAGAGGGG - Intergenic
1150280797 17:63928794-63928816 CAACCACTCCCACCCCAGGGAGG - Exonic
1151698735 17:75731374-75731396 CCACCCCGCTGCCCCCACAGAGG - Intronic
1152723847 17:81935747-81935769 CCACCAATCTGCCCCCAGCCTGG + Intronic
1203214635 17_KI270730v1_random:110462-110484 CAACAATTCTGCCACCTGAGAGG - Intergenic
1155939835 18:31792146-31792168 CTTCCACTCTGCCCTCAGTGTGG + Intergenic
1158037399 18:53050172-53050194 CATCCACTCTGCTGCCAGCGTGG - Intronic
1158130729 18:54149899-54149921 CAGCCATTCTGCCTCAAGAGTGG + Intergenic
1158225827 18:55199963-55199985 CAAACTCTCAGCTCCCAGAGAGG - Intergenic
1159375324 18:67585393-67585415 CAGCCCCTCTGCACCCATAGAGG - Intergenic
1159435992 18:68417945-68417967 CATCCCCTCTGCCCACACAGCGG + Intergenic
1161039391 19:2101874-2101896 CAAGGACTCGGCCCCCAGCGCGG + Exonic
1161719011 19:5892991-5893013 CACCCACCCCGCACCCAGAGGGG - Exonic
1162308483 19:9890224-9890246 CACCTTCTCTGCCCCCGGAGTGG - Intronic
1163577907 19:18121542-18121564 CTCCCACTCTGCCCCCAGCTGGG - Intronic
1163654898 19:18539867-18539889 TGGCCACTCTGCCACCAGAGTGG + Intronic
1163977755 19:20868520-20868542 CACCCACTCTGTCCTCACAGTGG + Intergenic
1163978334 19:20874110-20874132 CAGCCAGTCTGTCACCAGAGTGG + Intergenic
1165662679 19:37595254-37595276 TACCCACTCTGCACCCACAGAGG - Intronic
1166617379 19:44262323-44262345 CTGCCACTCTGCCTCCAGAGAGG - Intronic
1167145512 19:47679365-47679387 CAACCAGCCGGCCCCCAGTGTGG + Exonic
1167235039 19:48309156-48309178 CACCCACTCTGATCTCAGAGAGG + Intronic
1167810461 19:51825154-51825176 GAGCCACTCTACCCCCAAAGAGG - Exonic
925113788 2:1360345-1360367 CTCCCTCTCTGCCCTCAGAGTGG + Intronic
925562332 2:5211049-5211071 CCTCCACTCTGTCCACAGAGAGG - Intergenic
926682945 2:15677747-15677769 TTAACTCTCTGCCCCCAGAGAGG - Intergenic
929605192 2:43229011-43229033 CAACCACTCGGCCCCAAATGTGG - Intergenic
931064415 2:58569448-58569470 CAACCACTTTGCCAACAGACGGG - Intergenic
931308385 2:61055005-61055027 CTGCCTCTCTGCCCCCAAAGTGG + Intergenic
932343230 2:70979477-70979499 CAACCTCCCTGCCCCCAAAATGG - Intronic
933145611 2:78848857-78848879 CTACCACTCAGCCTCCTGAGTGG + Intergenic
933573130 2:84036758-84036780 CAAGCAGGCTGTCCCCAGAGAGG + Intergenic
934658973 2:96133080-96133102 CCACCACTCGCACCCCAGAGGGG + Intronic
948023014 2:234752556-234752578 CTACCACTCAGCCCACAGTGGGG - Intergenic
948375855 2:237519807-237519829 CCCACACTCAGCCCCCAGAGGGG - Intronic
948510085 2:238458267-238458289 CAACCACTCTCTCCTCAGGGTGG - Intergenic
1171892016 20:30725278-30725300 CAACCACCATGGCCCCTGAGAGG - Intergenic
1172086487 20:32388051-32388073 CACTCTCTCTGCCACCAGAGTGG + Intronic
1172106915 20:32522520-32522542 CCACCACTCTACCCCTGGAGAGG + Intronic
1172107047 20:32523072-32523094 CCACCACTCTACCCCTGGAGAGG - Intronic
1172425369 20:34852154-34852176 TAACCACTCTGCACCCAGCCTGG - Exonic
1173663938 20:44752321-44752343 CAACAGCTGTGCCTCCAGAGGGG + Intronic
1173787309 20:45803517-45803539 CAGCCACACTGGCCTCAGAGAGG + Intronic
1174982695 20:55414783-55414805 CAGTCACTCTGACCCCAGATGGG - Intergenic
1175384201 20:58583814-58583836 CGACCACGCAGCCCTCAGAGGGG + Intergenic
1175403826 20:58714824-58714846 CAGCCACTCTGTTCCCAGGGAGG - Intronic
1180879974 22:19196672-19196694 CAATCACTCTGCCCCACGCGTGG - Intronic
1183105941 22:35615260-35615282 CCTCCACCCTGCCCCCAGGGAGG + Intronic
1183325958 22:37194426-37194448 CAACCAGTTTGCACCAAGAGAGG + Intronic
1184189510 22:42885553-42885575 CACCCTCTCTGCCCCCAGCTGGG + Intronic
1184422248 22:44389091-44389113 GAAACACTCTGGCCCCAGAGTGG + Intergenic
1184768303 22:46583904-46583926 CAGCCACTCTGCCCTCAAGGAGG - Intronic
1203290948 22_KI270735v1_random:39260-39282 CAACAATTCTGCCACCTGAGAGG + Intergenic
952978423 3:38715682-38715704 CAACCACCCCACCCCAAGAGTGG + Intronic
952985857 3:38782346-38782368 AAACCACGGTGCCTCCAGAGGGG - Intronic
955520285 3:59769052-59769074 AAACCACTCTGCCAGCAGAAGGG + Intronic
956606294 3:71076188-71076210 CAGCCACCCTGGCTCCAGAGAGG + Intronic
957922629 3:86765420-86765442 CACCCACTTTGTTCCCAGAGAGG - Intergenic
961801402 3:129452865-129452887 CACCTCCTCTGCCCCCACAGAGG - Intronic
963745132 3:149118166-149118188 CACCCACCCTACCCCCAGGGAGG + Intergenic
963895905 3:150684635-150684657 CCACCACACTGCCGCTAGAGTGG - Intronic
964078014 3:152715436-152715458 CAACCCATCTGCCACCTGAGAGG - Intergenic
964538871 3:157756996-157757018 CAACCACCCGGCTCCCTGAGTGG + Intergenic
968520391 4:1032395-1032417 CAGCCACTGTGCCCCCAGCCTGG - Intergenic
968947553 4:3673401-3673423 AGACCACGGTGCCCCCAGAGTGG - Intergenic
969338059 4:6523134-6523156 CAAGGACTGTGCCCTCAGAGGGG + Intronic
969511098 4:7618389-7618411 CCTCCACTCTGCACCCGGAGGGG + Intronic
975812576 4:78184292-78184314 CAACTACTCTGCCACTACAGTGG + Intronic
976520976 4:86026068-86026090 CAACCATTCTCTCCCCAGTGAGG - Intronic
978713112 4:111809443-111809465 TAACCACTCTGCCTCCAAAGAGG + Intergenic
982635700 4:157894188-157894210 CAGTCACTCTGCCTCCATAGAGG - Intergenic
983344534 4:166510161-166510183 AAACCTCTCTTCCCCTAGAGTGG + Intergenic
984852057 4:184162934-184162956 CACCCACTCCGCTCCCCGAGTGG + Intronic
984866262 4:184283287-184283309 CACTCACACTGCCCCCAGATGGG - Intergenic
986684640 5:10265735-10265757 CAGGCAGTCTGACCCCAGAGTGG + Exonic
986886961 5:12250560-12250582 TATCCACTCAGCCTCCAGAGGGG - Intergenic
989663415 5:43824466-43824488 CAACCCCTCACCTCCCAGAGGGG + Intergenic
996472407 5:123876008-123876030 TAATCACTCTGCCACCAGAGAGG + Intergenic
996742719 5:126816361-126816383 CACCCCCTCTGCCCCCAAATAGG + Intronic
996962704 5:129270206-129270228 TCCCCACTCTGCCCCCAGTGAGG + Intergenic
998890814 5:146743842-146743864 CAATCAATCTGCCTCCATAGTGG + Intronic
1001301036 5:170534009-170534031 CAGCCAGTCTGTCCCCATAGAGG + Intronic
1003245444 6:4378485-4378507 CAAAGACTCCGCCCCCAGTGCGG - Intergenic
1007586696 6:42994929-42994951 TAACAACTCTGGCCTCAGAGAGG - Intronic
1007929298 6:45676127-45676149 CAGCCACTCTGTTCCCAAAGGGG + Intergenic
1010280175 6:74014172-74014194 CATTCACTCAGCTCCCAGAGTGG - Intergenic
1015296112 6:131595112-131595134 CAAACACTTTGTTCCCAGAGTGG + Intronic
1016658377 6:146545440-146545462 CAACCACTCTGCTACCAGCCAGG - Intronic
1019199031 6:170298874-170298896 CAACCACTCTCCAGGCAGAGGGG + Intronic
1019820421 7:3238899-3238921 CACCCCATGTGCCCCCAGAGTGG + Intergenic
1020246891 7:6436424-6436446 CACCCAGGCAGCCCCCAGAGAGG + Exonic
1021613480 7:22479621-22479643 CAACCTCTCTCCCCCTAGAGTGG + Intronic
1021616389 7:22506934-22506956 CAAGCAGTCAGCCCCCATAGTGG + Intronic
1024668415 7:51567793-51567815 CAACCAACATGCCCACAGAGGGG - Intergenic
1028376067 7:90147403-90147425 CAAGCAGTCAGCCCCCATAGTGG - Intergenic
1029824196 7:103172833-103172855 CAAGCAGTCAGCCCCCATAGTGG + Intergenic
1030139673 7:106291899-106291921 CAACCAGCCTGCCCACTGAGGGG + Intergenic
1031182522 7:118435776-118435798 CAACACCTCTGCCCCTACAGTGG + Intergenic
1031469098 7:122147611-122147633 CACCTGCTCTGCCCCCAGAATGG - Intergenic
1031497329 7:122466404-122466426 AAAACACTGTGGCCCCAGAGGGG - Intronic
1031826817 7:126575913-126575935 CATCCACTCTTCTCCCAGAATGG + Intronic
1035125889 7:156607598-156607620 CACCCACTCAGCTCCCAGCGCGG + Intergenic
1037114264 8:15204820-15204842 CTACCACTCTGTCCCAAGAGAGG + Intronic
1039566251 8:38554329-38554351 CACCCACTCAGCCCCCAGCTGGG + Intergenic
1041147595 8:54893966-54893988 CAACCACGGTGACCCCACAGTGG - Intergenic
1043519166 8:81025892-81025914 CACACACACTGCCCCCACAGAGG - Intronic
1045215851 8:100147602-100147624 CCTCCATTCTGCCACCAGAGTGG - Intergenic
1047541348 8:125769352-125769374 CAACCTCTATGCCCCCAAACTGG - Intergenic
1048799389 8:138182081-138182103 CTACCACGCTGCCACCACAGTGG + Intronic
1049403158 8:142439905-142439927 CAGCCATTTTGCCCCCACAGTGG + Intergenic
1049815248 8:144596188-144596210 CATCCCCTCTGCCCACTGAGGGG - Intronic
1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG + Intergenic
1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054368490 9:64368207-64368229 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054528233 9:66154300-66154322 CAACCACTATGGCCCCTGAGCGG - Intergenic
1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054927459 9:70602839-70602861 CAACCACTCTGCCAGCAGGAGGG - Intronic
1056923577 9:90813462-90813484 CAACCACTCTGCCCCCAGAGAGG - Intronic
1057204478 9:93163126-93163148 TATCCACTCTGCCCCCTCAGTGG + Intergenic
1058851064 9:109012957-109012979 CAACCACTCGCCCCGCGGAGGGG + Intronic
1058888181 9:109338827-109338849 AGACCACTCTGTCCCAAGAGTGG + Intergenic
1059354072 9:113686387-113686409 CCCCCACTCTGCCCCCAGCTAGG + Intergenic
1059766276 9:117386692-117386714 CATGCACTCTGCCCTCAGAGAGG - Intronic
1062236912 9:135514796-135514818 CACCCACTCCCACCCCAGAGAGG + Intergenic
1186794423 X:13030589-13030611 CAACCAGTCAGCTCCCAGAGCGG + Intergenic
1189782538 X:44530054-44530076 CAAGCAATCTGCCCCAAGTGGGG + Intronic
1191210117 X:57875930-57875952 CCACCCCCCAGCCCCCAGAGAGG + Intergenic
1193928667 X:87524047-87524069 CCAGCACTCTGCCCTCAAAGAGG + Intronic
1199780193 X:151051467-151051489 CTACCACTCTCACTCCAGAGAGG + Intergenic
1200032358 X:153306908-153306930 CAACCACCCTGCCCCCTCATAGG + Intergenic