ID: 1056924801

View in Genome Browser
Species Human (GRCh38)
Location 9:90825295-90825317
Sequence TTGAATCTACAGATCAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1590
Summary {0: 1, 1: 20, 2: 123, 3: 418, 4: 1028}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056924801 Original CRISPR TTGAATCTACAGATCAAGCT TGG (reversed) Intronic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
901172665 1:7272322-7272344 TTGAATCTGTAGATCAATTTGGG - Intronic
901189640 1:7401561-7401583 TTGAATCTATAGATCAGTTTGGG + Intronic
901266768 1:7916825-7916847 TTAAATCTACAGGTCAATTTAGG - Exonic
901313455 1:8288394-8288416 TTGAATCTGTAGATCAATTTGGG + Intergenic
902140922 1:14353851-14353873 TGGAATTTACAGATCAACTTAGG - Intergenic
902424347 1:16307860-16307882 TTGAATCTGTTGATCAAGTTGGG - Intronic
902903930 1:19540353-19540375 TTGAATCCATAGATCAAGTTGGG + Intergenic
903074680 1:20754413-20754435 TTGAACCTATAGATCAATTTGGG - Intronic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
903170545 1:21550025-21550047 TTAAATCCACAGATCAATGTGGG - Intronic
903584708 1:24403526-24403548 TTGAATCTATAGAACAATTTAGG + Intronic
903644169 1:24882350-24882372 CTGAATCTATAGATCAGGTTGGG + Intergenic
904338603 1:29814898-29814920 TTGAATCTATTGATCAATTTGGG + Intergenic
904537758 1:31211555-31211577 TTGAATCTGTAGATCAATTTGGG - Intronic
904776274 1:32909031-32909053 TTGAATCTGTAGATCAATTTGGG - Intergenic
904854160 1:33483771-33483793 TTGAATCTGTAGATCAAATTGGG + Intronic
904958823 1:34314033-34314055 TTGAATCTATAGATCAAATTGGG + Intergenic
904985295 1:34542314-34542336 TTGAATCTATAGATTAAGTTGGG - Intergenic
905288080 1:36898607-36898629 TTGAATCTACAGATCACTTTGGG - Intronic
905558102 1:38903650-38903672 TTGAATCTATAGATCAACTTGGG - Intronic
905593048 1:39181410-39181432 TTGAATCTATAGATCAGTTTGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
905963893 1:42072231-42072253 TTGAATCTATAGATCAAATTGGG + Intergenic
905966356 1:42100642-42100664 TTGAATCTGTAGATCAATTTGGG - Intergenic
906015396 1:42573212-42573234 TTGAATCTATAGGTCAATTTGGG + Intronic
906057528 1:42928624-42928646 TTGAGGCTACAGATGAAGATTGG + Intronic
906092139 1:43189309-43189331 TTGAATTTATAGATCAATGTGGG + Intronic
906111519 1:43326266-43326288 TTGAATCTATAGACCAATTTGGG - Intergenic
906368735 1:45234257-45234279 TTGAATCTACAGATAAATTTGGG - Intronic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907142459 1:52201050-52201072 TTGAATCTGTAGATCAAGTCAGG + Intronic
907154312 1:52319273-52319295 TTGAAGCTACAGATCAATTTGGG - Intronic
907302115 1:53494355-53494377 CTGAATCTGTAGATCAAACTGGG + Intergenic
907800013 1:57755251-57755273 TTGAATCTATAAATCAACTTGGG + Intronic
907881988 1:58558689-58558711 TTGACTCTATAGGTCAAGTTGGG - Intergenic
908793613 1:67808866-67808888 CTGAATCTATAGGTCAAGTTAGG - Intronic
909098280 1:71317252-71317274 TTGAATCTATAGATCAAGCTGGG - Intergenic
909179261 1:72400342-72400364 TTGAATCTATAGATCAAGCTGGG + Intergenic
909180797 1:72420982-72421004 TTGAATCTACACGTCAACCTGGG - Intergenic
909230040 1:73076724-73076746 TTGAATCTAAAGAACAATTTGGG - Intergenic
909589567 1:77330778-77330800 TTTAATCTACAGATCAATTTGGG + Intronic
909823035 1:80090067-80090089 TTGAATCTACAGATTACTTTGGG + Intergenic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
909922196 1:81396075-81396097 TTGAATCTATAGATCACTTTTGG + Intronic
910025839 1:82650529-82650551 TTGAATCTGTAGATCAATTTGGG - Intergenic
910084735 1:83386404-83386426 TTGAATCTATGGATCAAGCTGGG - Intergenic
910290351 1:85594594-85594616 TTAAATCTGCAGATCAGGCCAGG + Intergenic
910325844 1:86006088-86006110 TTGAATCTATAGATCACATTGGG - Intronic
910372668 1:86533652-86533674 TTGAATCTATACATCAAGTTGGG + Intergenic
910412321 1:86959867-86959889 CTGAATCTATAGATCACGTTGGG - Intronic
910735611 1:90453034-90453056 TTGAATCGACAGAAAAATCTGGG - Intergenic
910784593 1:90982267-90982289 TTAAATGTACATATCAAGGTAGG - Intronic
910932255 1:92454337-92454359 TTGAATCTATAAATCAATTTGGG + Intergenic
911172820 1:94787206-94787228 TTGAATCTATAGGTCAAGCTGGG - Intergenic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911403186 1:97402189-97402211 TTGCATCTATAGATCAAGCTGGG + Intronic
911471201 1:98320340-98320362 TTGAAGCTATAGATCGAGTTGGG - Intergenic
911729170 1:101274273-101274295 TTGAATCTATTAATCAATCTAGG - Intergenic
911934752 1:103955101-103955123 TTGAATCTAGAGATTGAGTTGGG + Intergenic
911970218 1:104425399-104425421 TTGAATCTATAGATAAATTTTGG - Intergenic
911992512 1:104719609-104719631 TTGAATCTATACATCAATTTGGG - Intergenic
912064135 1:105714374-105714396 TTGAATCTGCAGATCAGTTTTGG + Intergenic
912479357 1:109968320-109968342 TTGAATCTACAGATTGAGTTGGG - Intergenic
912767149 1:112424584-112424606 TTGAATCTAGAGATCAATTTGGG + Intronic
913028134 1:114867320-114867342 TTGAATCTGTAGATCAAGTTGGG + Intronic
913092599 1:115489174-115489196 TTGAATCTATAGCTCGAGCTGGG - Intergenic
913295376 1:117314254-117314276 GTGAATCTATAGATCAATATGGG + Intergenic
913468449 1:119167489-119167511 TTGAATCCATAGATCAATCTGGG + Intergenic
913664953 1:121039062-121039084 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914016344 1:143822333-143822355 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914161440 1:145138666-145138688 TTGAATCTTTAGATCAAGTTGGG + Intergenic
914511914 1:148340827-148340849 TTGAATTTATAGATCAAATTAGG + Intergenic
914654961 1:149730875-149730897 TTGAATCTTTAGATCAAGTTGGG - Intergenic
914792726 1:150892942-150892964 TTGTATCCATAGATCAATCTGGG + Intergenic
915388250 1:155517024-155517046 TTGAATCTACAGATCACTTTAGG - Intronic
915415640 1:155740561-155740583 TTGAATCTATAGGTCAATATGGG - Intergenic
915423913 1:155807871-155807893 TTGAATCTGTAGATCAATTTGGG + Intronic
915871728 1:159567802-159567824 TTAAATCTACAGATCAAGTTGGG - Intergenic
915889344 1:159757264-159757286 TTGAATCTCCAGATTATGCCTGG - Intergenic
916559591 1:165922250-165922272 TTGAATCCATAGATCAATTTGGG + Intergenic
916709010 1:167385260-167385282 TTGAATCTAGAGGTCAATTTGGG - Intronic
916775635 1:167960909-167960931 TTGAATCTATAGAACAAGTTGGG + Intronic
916937934 1:169649522-169649544 TTAAATCTAAAGATCAAGTTGGG - Intergenic
917001084 1:170360526-170360548 TTGAATCTACAGATTAATTTAGG - Intergenic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917157129 1:172015334-172015356 TTGAATCTATAGATTAAGTTGGG + Intronic
917254955 1:173104058-173104080 ATGAATCTATAGATCAATATGGG + Intergenic
917551660 1:176038318-176038340 TTCAATCTATAGATCAATTTGGG - Intronic
917568572 1:176237710-176237732 CTGAATCTATAGATCATGTTAGG + Intergenic
917586106 1:176427476-176427498 TTTAATCTACAAATCAAGCTTGG + Intergenic
917757196 1:178113750-178113772 TTAAATCTATAGATCAATTTTGG + Intronic
917880712 1:179333281-179333303 TTGATTCTATAAATGAAGCTCGG - Intronic
917907919 1:179607004-179607026 TAGAATCTATAAATCAAGTTGGG + Intronic
917991919 1:180388977-180388999 TTGAATCTATAGATCAGCTTGGG - Intronic
918090041 1:181282700-181282722 TTGAATCTACAGATCAAGTTGGG + Intergenic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918532120 1:185535041-185535063 GTGAATCTACAGATCATTTTGGG + Intergenic
918539895 1:185619727-185619749 ATGAATCTATAGATCAAGTTGGG + Intergenic
918539921 1:185620413-185620435 TTGACTCTATAGATCAAGTTGGG - Intergenic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
919028946 1:192214232-192214254 TTGAATATACAAACCAAGTTGGG - Intergenic
919717051 1:200789725-200789747 TTGAATCTGTAGATCAAGTTGGG + Intronic
920042219 1:203107851-203107873 TTGAAACTACAGATTAATATAGG + Intronic
920168286 1:204052126-204052148 TTGAATCTATATATCAATTTTGG + Intergenic
920780191 1:208982667-208982689 TTGAATTTATAGATCAATGTGGG + Intergenic
920926941 1:210350342-210350364 TTGAATCTATAGATTAAGTTGGG + Intronic
920985013 1:210880162-210880184 TTAAATCTACAGATCAATTTGGG - Intronic
921093289 1:211863545-211863567 TTGAATCTACAGATCAAGTTGGG + Intergenic
921267598 1:213436574-213436596 TTGACTCTACATATCAAGTAGGG + Intergenic
921521398 1:216158778-216158800 TGGATTCTACAGATCAAACTAGG + Intronic
921605501 1:217149010-217149032 ATAAATCTATAGATCAAGTTGGG - Intergenic
922181444 1:223236917-223236939 TTGAATCTATAGAGCAAGTTGGG + Intronic
922254521 1:223881893-223881915 TTGAATATACAGATCAATTTTGG - Intergenic
922381323 1:225030942-225030964 TTGAATATATAGATCAATCTGGG + Intronic
922656021 1:227384206-227384228 TTGAATTTATAGATCAAGTTAGG - Intergenic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923420083 1:233804790-233804812 TTAAATCTATAGATCAAGTTGGG - Intergenic
923429043 1:233903278-233903300 TTGAATCTATAGATGAAGTTGGG + Intergenic
923619071 1:235562721-235562743 TTGAATCTACAGATCAAGTTGGG + Intronic
923660902 1:235956443-235956465 TTGCATCTACAGGTCACTCTGGG - Intergenic
923708876 1:236369267-236369289 TTAAATCTATAGATCCAGGTGGG + Intronic
923775322 1:236973054-236973076 AGGAATCTATAGATGAAGCTGGG - Intergenic
923818635 1:237408745-237408767 TTGAAACTATAGATCAAATTGGG + Intronic
923952480 1:238973702-238973724 TTGAATCTATAGATTAAAATGGG + Intergenic
924204011 1:241692225-241692247 TTGACTCTACATATCAAGTTGGG - Intronic
924214257 1:241804231-241804253 TTGAATTTTTAGATCAAGTTGGG - Intergenic
924260856 1:242229523-242229545 TTGGATCTATAGATCAATTTGGG + Intronic
924364575 1:243278056-243278078 TTGGATCTATTGATCAAGTTGGG + Intronic
924485918 1:244484254-244484276 TTGAATGTATAAATCAAGTTGGG - Intronic
1062962519 10:1583657-1583679 TTGAATCTACAAATCAAGTGAGG - Intronic
1063012070 10:2032639-2032661 TTGAATCTATAGACCAAGATAGG + Intergenic
1063188856 10:3674896-3674918 TTAAATCTATAGATCAATTTTGG - Intergenic
1063395236 10:5681221-5681243 CTGAATGTACATATCAATCTGGG - Intergenic
1063732259 10:8711187-8711209 TTGAATCTCCAGATCAATTTGGG + Intergenic
1063740444 10:8812648-8812670 CTGAATCTATAGATTAATCTCGG - Intergenic
1063895191 10:10672862-10672884 TTGAATTTGTAGATCAAGTTGGG + Intergenic
1063912190 10:10841859-10841881 TTGAATCTATAAATCAAATTGGG + Intergenic
1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG + Intergenic
1063976475 10:11421572-11421594 TTGAATCTATAGACCAAGTTAGG - Intergenic
1064607210 10:17055842-17055864 TTGAATTTACAGACCAATTTGGG - Intronic
1064779151 10:18814162-18814184 TTGAATCTATACAACAAGTTGGG + Intergenic
1064781874 10:18849500-18849522 TTGCATCTGTAGATCAAGCTGGG + Intergenic
1064790030 10:18947607-18947629 TTGAATCTCTAGATCACGTTGGG + Intergenic
1064838110 10:19557838-19557860 TTGAATCTATAAATTAAGTTGGG + Intronic
1064939795 10:20721064-20721086 TTGAATCTACAAATCACCTTGGG + Intergenic
1065192825 10:23229897-23229919 TTAAATCTACAGTTCAATTTAGG - Intronic
1065277703 10:24102464-24102486 TTGAATCTATACATCAAGTTGGG - Intronic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065526457 10:26626525-26626547 TGGAATCTGCAGAGCAAGTTGGG + Intergenic
1065530044 10:26660144-26660166 TTGAATCTAGAGAGAAAGTTGGG + Intergenic
1065556914 10:26925055-26925077 TTGAATCTAGAGAGCAAGTTGGG - Intergenic
1065607549 10:27435006-27435028 ATAAATCTACAGATCAATTTGGG - Intergenic
1065615643 10:27519747-27519769 TTGAATCTATAGATCACTTTGGG - Intronic
1065758215 10:28954847-28954869 TTGAATCTGTAGATCAATCTGGG - Intergenic
1065818477 10:29503776-29503798 TCGAATGTACAGCTCAAGTTGGG - Intronic
1065941700 10:30570384-30570406 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1065954441 10:30680723-30680745 TTGAATTTATAGATCGAGTTGGG + Intergenic
1066248268 10:33606155-33606177 TTGAATCTTTAGATCAAACTGGG + Intergenic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1067016974 10:42764704-42764726 TTGAATCTATAGATCAAGAAGGG - Intergenic
1067235643 10:44446298-44446320 TTGAAACTAAAAATCAAGTTGGG - Intergenic
1067264537 10:44726990-44727012 TTGAATCTGTAGATCAATGTAGG + Intergenic
1067778668 10:49181285-49181307 TTAAACCTATAGATCAATCTGGG - Intronic
1067898148 10:50208735-50208757 TTGAATTTACAGATTAATTTGGG - Intronic
1068497343 10:57800100-57800122 TTGAATCTATAGATCAATTCAGG + Intergenic
1068817119 10:61329557-61329579 TTGAATCTACAGATCATACTGGG + Intergenic
1068824829 10:61424482-61424504 TTGAATCTAAAGATCAATTTGGG - Intronic
1068979655 10:63048792-63048814 TTCAATCTGCAGATCAATTTGGG - Intergenic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069284898 10:66701419-66701441 TTAAATCTACAGATCAATTGAGG + Intronic
1069378053 10:67813920-67813942 TTGAATCTGCAGATCAGTTTGGG - Intronic
1069468633 10:68665340-68665362 TTGAATCTAGAGATCAATTTTGG + Intronic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1069647585 10:70014504-70014526 TTGAACCTAAAGATCAAATTTGG - Intergenic
1069647679 10:70015689-70015711 TTGAATCTATAGATCACTTTGGG - Intergenic
1070072902 10:73106952-73106974 TTGAATCTGTAGATCAATTTGGG + Intergenic
1070317198 10:75325683-75325705 ATGAATCTACAGATCAATTTGGG + Intergenic
1070533232 10:77355668-77355690 TTGAGCCAACAGATCAAGTTTGG + Intronic
1070945203 10:80385177-80385199 TTGAATCTATAGTTCAAGTTGGG + Intergenic
1071073294 10:81720769-81720791 TTGAATCTGAAGATCAAATTGGG - Intergenic
1071081018 10:81811284-81811306 TTGAATCTATTGATCAAGTTGGG - Intergenic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1071498305 10:86185049-86185071 TTGAATCTATAGATTAATTTGGG + Intronic
1071618946 10:87100931-87100953 TTGAATCTGTAGATCAATTTGGG + Intronic
1072052268 10:91717576-91717598 TTGAATCTATAGACCAATTTGGG - Intergenic
1072123778 10:92427842-92427864 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1072142159 10:92598657-92598679 TTGAATCTATAGATCACTTTGGG + Intronic
1072173362 10:92890037-92890059 TTGAATCTATAGATGAAGTTGGG + Intronic
1072174543 10:92905342-92905364 TTGAATCTGTAGATCAAGTTGGG + Intronic
1072178780 10:92958620-92958642 TTAAATCTGTAGATCAAGTTGGG - Intronic
1072366010 10:94710445-94710467 TTGAATCTGTAGATCAATTTGGG + Intronic
1072406445 10:95158369-95158391 TTGAATCTACAAATCACTTTGGG - Intergenic
1072609613 10:97008723-97008745 TTGAATCTGTAGATCAATTTAGG - Intronic
1072837530 10:98732207-98732229 TTGAATCTATAAATCAATTTAGG - Intronic
1072841717 10:98782434-98782456 TTGAATCTAAAAATCAATTTGGG - Intronic
1072884103 10:99258458-99258480 TTGAATCTACAGAACTATTTTGG - Intergenic
1072908546 10:99478921-99478943 TTGAATCTACAGATCATTTTGGG - Intergenic
1073012003 10:100367847-100367869 TTGAATCTGTAGATCAATTTGGG - Intergenic
1073279093 10:102338919-102338941 TTGAGTCTATAGATCAATTTGGG - Intronic
1073283423 10:102371497-102371519 TTGAATTTACAGATCAATTTGGG - Intronic
1073334429 10:102695198-102695220 TTAAATCTATAAATCAAGTTGGG + Intronic
1073635803 10:105197429-105197451 TTGAATCTACAGCACATGTTTGG - Intronic
1074248699 10:111721822-111721844 TTAAATCTATAGATCAAGCCGGG - Intergenic
1074390400 10:113052713-113052735 ATGAATCCGCAGTTCAAGCTTGG - Intronic
1074605973 10:114966552-114966574 TTGAAGCTATAGATCAATTTTGG + Intronic
1074619202 10:115100803-115100825 TTGAGTCTATAGATCAATTTTGG + Intronic
1074628805 10:115225793-115225815 TTAAATCTACAGATCAATTTGGG - Intronic
1074629670 10:115238318-115238340 CTGAATCTGCATATCAAGCTGGG + Intronic
1075267579 10:121016460-121016482 TTGAATCCACAGATAAAACTGGG - Intergenic
1075488030 10:122842675-122842697 CTGAATTTATAGATCAACCTGGG + Intronic
1075490280 10:122861508-122861530 TTGAATCTGTAGATCAAATTGGG + Intronic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1075951736 10:126483967-126483989 TTGAGCCTACAGAGCAAGGTGGG - Intronic
1076020998 10:127073228-127073250 GTGAATCTGTAGATCAAGTTGGG - Intronic
1076286300 10:129300332-129300354 TTGAATCTACAGGTTAAGTGGGG - Intergenic
1076633076 10:131864037-131864059 TTGAACCTATAGATCAAGTTGGG - Intergenic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1076775598 10:132696258-132696280 TTGAATCTATAGCTGAAGTTGGG - Intronic
1076928963 10:133514881-133514903 TTGAATTTATAGATAAAACTGGG - Intergenic
1077290545 11:1788539-1788561 TTGATTCTACAGATCACTTTGGG + Intergenic
1077290810 11:1791105-1791127 TCGAATCTACAGATGAAGTTGGG + Intergenic
1077475174 11:2784596-2784618 TTGAATCTATAGATCCATTTGGG + Intronic
1077864143 11:6209382-6209404 TTGAATTTACAAATCAAGGGGGG - Intronic
1078050255 11:7959481-7959503 TTGAATCTACAGATCAAACTGGG + Exonic
1078554134 11:12304985-12305007 TTGAATCTATAGATAAATTTGGG + Intronic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1078936903 11:15959852-15959874 TTGCTTCTACAGATCTAGTTTGG + Intergenic
1078960190 11:16257133-16257155 TTGAATCTATAGATCAAATGGGG - Intronic
1078992128 11:16659593-16659615 TTGACTCCATAGATCAAGTTGGG + Intronic
1079072644 11:17361256-17361278 TTGAATCTAGAGATCAAGTTGGG + Intronic
1079107782 11:17583878-17583900 TTGAATTTATAGATCAATTTGGG + Intronic
1079564300 11:21862865-21862887 TTGAATCTATAAATCAAGTTGGG + Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1080357337 11:31465376-31465398 TTGAATCTTTAGATCAAATTGGG - Intronic
1080429002 11:32181653-32181675 TAGAATCCAGAGATCAGGCTGGG - Intergenic
1080506696 11:32921702-32921724 TTGAATCTAAACATCAATTTGGG - Intronic
1080530540 11:33171191-33171213 TTGAAACTATAGATCAATTTGGG - Intergenic
1080996649 11:37610681-37610703 TTGAAACTATAGGTAAAGCTTGG - Intergenic
1081293623 11:41357834-41357856 TTAAATCTGTAGATCAAGTTGGG - Intronic
1081327729 11:41766670-41766692 TTGAATCTATAGATCATTTTGGG + Intergenic
1081422355 11:42884360-42884382 TTGAATCTACAGATAAATTTGGG - Intergenic
1081555195 11:44153085-44153107 TTGAATCTATAATTCAAGTTGGG + Intronic
1081576554 11:44322159-44322181 TTGGATTTACAGAACAAGGTTGG - Intergenic
1081642811 11:44768168-44768190 TTGAATCTGTATATCAAGTTGGG + Intronic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1081979207 11:47255962-47255984 TTGAAACTACAGATCATGCAGGG - Intronic
1083093695 11:60227219-60227241 TTAAATCTACAGATTAAATTGGG - Intronic
1083916838 11:65751698-65751720 TTGAATCTATAGACCAAGTTAGG + Intergenic
1084015493 11:66377787-66377809 CTTAATCTATAGATCAAGTTGGG + Intergenic
1084282887 11:68110622-68110644 TTAAATCTACAGATCAAGTTGGG - Intronic
1084314072 11:68333848-68333870 CTGAATCCACTGATCAATCTGGG - Intronic
1084339409 11:68484953-68484975 TTGAATCTGTAGATCAAGTTAGG + Intronic
1084350796 11:68597679-68597701 TTTAATGTACAGTTCAAGGTTGG + Intronic
1084766782 11:71315028-71315050 TTGAATCTATGGATCAAGCTGGG + Intergenic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1084923600 11:72493402-72493424 TCGAACTTACAGATCAATCTGGG - Intergenic
1085106541 11:73848513-73848535 TTGAATCTGTAGATCAATTTGGG + Intronic
1085443791 11:76586569-76586591 TTGACTCTACAGGTCAATTTGGG + Intergenic
1085938617 11:81180921-81180943 TTGAACCTATAGATCAAGTTTGG + Intergenic
1086000651 11:81980962-81980984 TTGAATCTATAGATCAACTTTGG + Intergenic
1086357582 11:86020294-86020316 TTGAATCTATAGATCAGTTTGGG - Intronic
1086384992 11:86298000-86298022 TTGAATCTGTAGATCAATTTGGG + Intergenic
1086391110 11:86364344-86364366 TTGAATCTACTTATCAAATTGGG + Intergenic
1086780876 11:90904310-90904332 TTGAATCTGTAGATCAATTTGGG - Intergenic
1087300287 11:96425440-96425462 TTGACACTTTAGATCAAGCTGGG + Intronic
1087637882 11:100723345-100723367 TTCAATCTATAGATCAAGTTGGG + Intronic
1087808670 11:102585176-102585198 TTGAATCTACAGATCAATTTGGG + Intronic
1087957798 11:104310562-104310584 TTGAATCTATTGATCAAATTTGG - Intergenic
1088163058 11:106897270-106897292 TTGAATCTATAGAGCAAGTGGGG - Intronic
1088383966 11:109231046-109231068 TTGAATCTATAGGTCAATTTAGG - Intergenic
1088395355 11:109361920-109361942 CTGAATGGACAGCTCAAGCTAGG + Intergenic
1088634124 11:111803076-111803098 TTTAATCTATAGATCAAATTGGG - Intronic
1088710343 11:112502390-112502412 TTGAATCTATAGATCAAATTGGG + Intergenic
1088948843 11:114544158-114544180 TTGAATCAATAAATCAAGTTGGG - Intronic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1089087368 11:115833688-115833710 TTAAATCTATAGATCAATTTAGG - Intergenic
1089107047 11:116019583-116019605 TTGAATCTATAGATTAATTTAGG + Intergenic
1089226562 11:116928382-116928404 TTTAATCAACTGATCTAGCTGGG + Intronic
1089956863 11:122579350-122579372 TTGATTGTACAAATTAAGCTTGG - Intergenic
1090112762 11:123933275-123933297 TTGAATCCATAGATCAATTTAGG + Intergenic
1090113051 11:123937044-123937066 TTGAATCTATAGATCAAATTGGG + Intergenic
1090143125 11:124287303-124287325 TTGAATTTATAGATCAAATTGGG + Intergenic
1090246251 11:125218007-125218029 TTGAATCACCAGATCAAACAGGG - Intronic
1090552225 11:127834105-127834127 TTGACTCTATAGATCAATTTAGG - Intergenic
1090754405 11:129776587-129776609 TGGAATCTATAGATCAAGTTGGG - Intergenic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1091188453 11:133668535-133668557 TTGAATGTAGAGATCAATCTGGG + Intergenic
1091249553 11:134131127-134131149 CTGAATCTAGAGATCAGCCTGGG - Intronic
1091438353 12:492539-492561 TTGAGTCTGTAGATCAAGTTGGG - Intronic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1091594031 12:1863488-1863510 TTGAATCTATAAATCAATTTGGG + Intronic
1091711617 12:2744535-2744557 TTTAAGTTACAGATCAATCTGGG - Intergenic
1091830611 12:3547835-3547857 TTAAATCTATAGATCAATTTGGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1092037839 12:5355185-5355207 TTGAATCTATAGGTCAACTTGGG - Intergenic
1092175670 12:6404412-6404434 TTGAATCTATAGATCAAACTGGG + Intergenic
1092566958 12:9675706-9675728 TTTAATCTGTAGATTAAGCTGGG + Intronic
1092609505 12:10156685-10156707 TTGAATCTACAAATCGATTTGGG - Intergenic
1093109965 12:15139388-15139410 TTGAATCTATAGGTTAAGTTGGG + Intronic
1093298550 12:17422955-17422977 TTGAATTTATAGATCAAGGTGGG + Intergenic
1093343203 12:18005433-18005455 TTGAATCTATAGATCAAGCTGGG - Intergenic
1093399991 12:18734044-18734066 TTGAATCTATAGATCACCTTGGG + Intronic
1093631175 12:21411645-21411667 TTGAAGCTACAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1093900806 12:24629663-24629685 TTGAATCTACAGATAAATTTGGG + Intergenic
1094145404 12:27223249-27223271 TTAAATCTATAGATCAAGTTGGG - Intergenic
1094357973 12:29598458-29598480 CTGAATCTATAGATCACTCTGGG + Intronic
1094394155 12:29987131-29987153 TAAAATCTATAGATCAAGTTGGG + Intergenic
1095235735 12:39793395-39793417 TTGACTCTATAGATCAATTTGGG - Intronic
1095325890 12:40891953-40891975 TTGAATCTGTAGATCAAGCTGGG + Intronic
1095833708 12:46614622-46614644 TTGAATCTATAGATGAATTTAGG - Intergenic
1095835540 12:46634540-46634562 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1095934375 12:47660562-47660584 TTGAATCTACATATAATGCCAGG - Intergenic
1096039747 12:48503464-48503486 TTCAATCTATAGATCAAATTGGG - Intergenic
1096435545 12:51588197-51588219 TTGAATCTGTAGATCAACTTGGG - Intergenic
1096568567 12:52502683-52502705 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096932709 12:55231930-55231952 TTGAATCTATAGATAAAGTTGGG - Intergenic
1096936209 12:55280200-55280222 TTGAACCTATAGATCAATTTCGG - Intergenic
1097081816 12:56437256-56437278 TTGAATCAACAGATTATCCTGGG + Intronic
1097298742 12:57995975-57995997 TTGAATCTGCAGATCACTTTGGG + Intergenic
1097371775 12:58791465-58791487 TTGAATCTATAGATCACTTTGGG - Intronic
1097728443 12:63100579-63100601 TTGAATCTATAATTCAAGTTGGG - Intergenic
1097778682 12:63678012-63678034 TTGAATATATAGATCAAGTTGGG + Intergenic
1097965659 12:65577597-65577619 TTGAAGCTACAGATCAATTTGGG - Intergenic
1098839582 12:75462686-75462708 TTGAATCTACAAATTACTCTGGG + Intergenic
1099243908 12:80171724-80171746 TTAAATCTACAGATCAATTTGGG + Intergenic
1099244359 12:80177648-80177670 TTTAATCTATAGATCAATTTTGG + Intergenic
1099306426 12:80961940-80961962 TTAAATCTACAGATCAATTTGGG + Intronic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1100462127 12:94810084-94810106 TTGAATCTACATATCACTTTGGG - Intergenic
1100683395 12:96956320-96956342 CCGAATCTACAGATCAATGTGGG - Intergenic
1100872802 12:98929351-98929373 TTGAATCTGTAGATCAATTTGGG - Intronic
1101142211 12:101808187-101808209 TTGAATCTGTAGATGAAGTTGGG - Intronic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1101525748 12:105528024-105528046 TTGAATTTATAGATCAATTTTGG + Intergenic
1101536361 12:105620895-105620917 TTGAATCTGCAGATCACTTTGGG + Intergenic
1101649569 12:106663125-106663147 TTGAATCTGTTGATCAAGATGGG + Intronic
1102203168 12:111072181-111072203 CTGAGTCTATAGATCAAGTTGGG + Intronic
1102319833 12:111923009-111923031 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1102640664 12:114363673-114363695 TAGAATCTGCAGACCAGGCTGGG + Intronic
1102851927 12:116254970-116254992 TTGAATCTGTAGATCAAATTGGG - Intronic
1104711005 12:130986216-130986238 TTGAATATATAGATCAATTTGGG + Intronic
1105044288 12:132988697-132988719 TTCAATCTGTAGATCAAGTTGGG + Intronic
1105515173 13:21083223-21083245 TTGAATCTGTAGATCAATTTTGG - Intergenic
1105730217 13:23206889-23206911 CTGAATCTACAGATCACTTTTGG - Intronic
1106045853 13:26141051-26141073 TTGAATCTGTAGATCAATTTGGG - Intronic
1106122444 13:26871849-26871871 TTAAATATACATCTCAAGCTGGG + Intergenic
1106299997 13:28455076-28455098 TTGAATCTGCAGATCAAGTTGGG - Intronic
1106341579 13:28834097-28834119 TTAAATCTGCAGATCAATATGGG - Intronic
1106556650 13:30815033-30815055 TTGACTCTATAGATGAAGCTGGG + Intergenic
1106671626 13:31912229-31912251 CTGAATCTGCAGATCCAGCCTGG - Intergenic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1106869553 13:34003871-34003893 TTAAATCTACAGATGGATCTTGG + Intergenic
1106936480 13:34727858-34727880 TTAAATCTACAGATCTTTCTTGG - Intergenic
1107452654 13:40525145-40525167 TTAAATCTATAGATCATGTTTGG - Intergenic
1107763417 13:43707323-43707345 TTGAATCTACAAATCAACTTTGG - Intronic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1108019959 13:46117832-46117854 TTGAGTCTATAGATCAATGTGGG - Intergenic
1108126256 13:47246709-47246731 TTGAATCTACAGATTATATTGGG + Intergenic
1108427400 13:50317338-50317360 TTGAATCCATAGATCAAATTGGG - Intronic
1108464635 13:50702417-50702439 TTGAATCTACAGATCACTTTAGG - Intronic
1108490245 13:50974632-50974654 TTGTATCAACAGGTAAAGCTAGG - Intergenic
1108667558 13:52647884-52647906 TTGAGTCTATAGGTCAATCTTGG + Intergenic
1108903240 13:55438798-55438820 TTGAATCTATAGATAAATTTGGG - Intergenic
1108926137 13:55748240-55748262 TTGAATCTGAAGGACAAGCTGGG - Intergenic
1109087478 13:57993780-57993802 TTAAATCTATAGATTAAGTTGGG + Intergenic
1109239684 13:59870541-59870563 TTGAACCCATAGATCAAGTTGGG + Intronic
1109596104 13:64555978-64556000 TTGAATCTCCAGATCACTTTGGG + Intergenic
1109691569 13:65899032-65899054 TTGAATCTATAGATCATTTTTGG + Intergenic
1109901821 13:68782811-68782833 TTGAATCTATACATCAAATTGGG + Intergenic
1109985800 13:69983270-69983292 TTGAATCTGCAGATCACTGTAGG - Intronic
1109992434 13:70076058-70076080 TTTAATTTACAGATCAAGTTTGG - Intronic
1110047723 13:70851855-70851877 TTGAATTTACACATCAATTTAGG - Intergenic
1110400572 13:75086246-75086268 TTGAATCTGTAGATCAATCTGGG - Intergenic
1110490375 13:76096808-76096830 TTAAATCTGTAGATCACGCTGGG - Intergenic
1110827015 13:79983202-79983224 CAGAATCTATAGATCAAGTTGGG + Intergenic
1110923799 13:81124539-81124561 TTGAATCTACAGATAATTTTAGG + Intergenic
1110932594 13:81240882-81240904 TTTAATCTGTAGATCAATCTGGG - Intergenic
1111263144 13:85770052-85770074 TTCAGTCTACAGATCAGGTTGGG + Intergenic
1111294564 13:86262147-86262169 TTGAATCTGTAGATCAATGTGGG + Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111665977 13:91268493-91268515 TTGAATCTATAGAACAATTTAGG + Intergenic
1111764062 13:92504411-92504433 TTAAATCTACAGATCATTTTGGG - Intronic
1112055528 13:95686945-95686967 TTGAATCTACAGATTACTATGGG + Intronic
1112258798 13:97858918-97858940 TAGAATCTACACATTAAGCAAGG - Intergenic
1112270617 13:97965419-97965441 TTGAATCTATAGATTAAGGGAGG + Intronic
1112536748 13:100265647-100265669 TTGAATCTAGAGATTATTCTGGG + Intronic
1112759906 13:102683229-102683251 TTGAATCCAGAAATCTAGCTTGG - Intergenic
1112915471 13:104544521-104544543 TTCAATCTGCAGATCACTCTTGG + Intergenic
1113275451 13:108723889-108723911 TTGAATCTACAGATCAATTTGGG + Intronic
1113306771 13:109088023-109088045 TTGAATGTACAAAACAGGCTGGG + Intronic
1113584357 13:111453994-111454016 TTGAATCTTCAGATAAATGTGGG - Intergenic
1113634041 13:111907798-111907820 TTATATCTCCAGATCAAGCAAGG - Intergenic
1113821021 13:113213056-113213078 TAGAATCTACAGATCAATGTAGG + Intronic
1113924493 13:113933567-113933589 TTGATTCTGGAGATCAATCTGGG + Intergenic
1114068267 14:19085394-19085416 TTGAATCTATAGATCAAGAAGGG + Intergenic
1114093997 14:19314631-19314653 TTGAATCTATAGATCAAGAAGGG - Intergenic
1114276291 14:21148371-21148393 TTGAATCTGTAGATCAATTTGGG - Intergenic
1114276613 14:21152263-21152285 TTGAATCTCAAGATCAATTTGGG + Intergenic
1114505931 14:23213430-23213452 TTGAATCTATAGATCAAATTGGG - Intronic
1114863411 14:26556078-26556100 TTGCATCTATAGATCAAGTAGGG - Intronic
1114908730 14:27164627-27164649 TTGAATGTATAGATTAAGTTGGG + Intergenic
1114990629 14:28283598-28283620 TTGAATATATGGATAAAGCTGGG - Intergenic
1115064979 14:29247799-29247821 TTGCATCTATAGTTCAAGTTTGG + Intergenic
1115167681 14:30467469-30467491 TTGAATCCACAGAACAATTTGGG - Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115325855 14:32137633-32137655 TTGAATCTGTAGATCAATTTGGG + Intronic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115678322 14:35706911-35706933 TTGAATCTACAGATTAAGTAGGG + Intronic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1116149288 14:41118346-41118368 TTGAATCTATAGATCATTTTGGG - Intergenic
1116356116 14:43933415-43933437 TTGAATCTATAAATCAAGTTTGG - Intergenic
1116664108 14:47753053-47753075 TGGAATCTACAGATCTATTTTGG - Intergenic
1116665782 14:47773186-47773208 TTGAATTTACAGATCAAGTTTGG - Intergenic
1116692845 14:48132745-48132767 ATGAATGTACAGATCCAGTTTGG - Intergenic
1116834405 14:49756169-49756191 TTGAATCTGTAGATCAAGTGAGG + Intergenic
1117018020 14:51538928-51538950 TTGAATCTGTAGATCAATTTGGG + Intronic
1117077233 14:52116822-52116844 ATGAATCTACAAATCGAGGTAGG - Intergenic
1117259339 14:54014625-54014647 TTGAATCCAGAGATCAAGTTGGG + Intergenic
1117607677 14:57447305-57447327 TTGACTCTATAGATCAAGTTTGG + Intergenic
1117931368 14:60844293-60844315 TTGGATCTATAGATCAATGTGGG + Intronic
1118452302 14:65914441-65914463 TTGAATCTGTAGATCAATTTAGG - Intergenic
1118463286 14:66006773-66006795 TTGAATGTAGAGATCAATTTGGG + Intergenic
1118529531 14:66687415-66687437 TTGAATCTATAGATCACTGTTGG + Intronic
1118794273 14:69126488-69126510 TTGAATCCATAGATGAAGTTGGG - Intronic
1118798195 14:69164403-69164425 TTGAATCTATAGATCACTTTGGG - Intergenic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119413234 14:74451000-74451022 ATGAATCCATAGATCAATCTGGG - Intergenic
1119751215 14:77078828-77078850 TTGAATCCCTGGATCAAGCTTGG - Intergenic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1120066593 14:80048194-80048216 TTAAATCTACAAATAAAGCACGG - Intergenic
1120078988 14:80193765-80193787 TTGAATCTACAGATCACATTGGG - Intergenic
1120110549 14:80549510-80549532 TTAAAACCAAAGATCAAGCTAGG - Intronic
1120581832 14:86261153-86261175 ATGAATCTATAGATCAAATTTGG + Intergenic
1120792063 14:88593301-88593323 TTGAATCCATAGATCAACTTGGG - Intronic
1121158889 14:91715591-91715613 TTGAATCTATAGATCAGTTTAGG - Intronic
1121167549 14:91821051-91821073 TTGAATCTGTAGATCAATTTGGG - Intronic
1121316851 14:92966518-92966540 TTGAGTCTATAGATCAATTTGGG - Intronic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1122176483 14:99924008-99924030 TTTAATTTACAGATCAATATGGG + Intronic
1122305108 14:100760199-100760221 TTGACTCTACAGATCAATTTGGG - Intergenic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123726216 15:23104547-23104569 TTGAGTCTATAGATCAATTTGGG + Intergenic
1123953089 15:25303691-25303713 TTGAATCTACAGATCACTTTGGG + Intergenic
1123969835 15:25497220-25497242 ATGAATCTATGGATCAAGTTGGG - Intergenic
1124029553 15:25997467-25997489 TTGGATCTACAGATCAACTTGGG + Intergenic
1124107727 15:26756272-26756294 TTAAATATACAGAACAGGCTGGG + Intronic
1124114027 15:26822625-26822647 TTGAATCTATAGATTAATTTAGG - Intronic
1124393402 15:29279690-29279712 TTGAGTCTGCAGATCAATTTGGG + Intronic
1124586008 15:31007747-31007769 TTAAATCTACAGATAAACTTGGG + Intronic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1124622872 15:31286989-31287011 TTGAGTCTAGAGATCAATCTGGG + Intergenic
1124713746 15:32037481-32037503 TTGAATCTGTAGATCAAGTTGGG + Intronic
1124873751 15:33570652-33570674 TTGAATCTAGAGATCAGTTTTGG + Intronic
1125074914 15:35602678-35602700 TTGAATCTGCAGATTAAGTAAGG - Intergenic
1125167001 15:36718421-36718443 TTGAATTTACAGATCAATTTGGG + Intronic
1125349081 15:38748838-38748860 TTCATTCTAAAGATCAAGCCTGG + Intergenic
1126045994 15:44640437-44640459 TTAAATCTATATATCAAGTTGGG - Intronic
1126310928 15:47315664-47315686 TTTAATCTGTAGATCAAGTTGGG + Intronic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1126642208 15:50839669-50839691 TTTAATCTACAGATTATGTTAGG + Intergenic
1126658625 15:51008800-51008822 TTGAATCTAAAGATCAAGTTGGG + Intergenic
1127181109 15:56418968-56418990 TTGAATCTATAGATCAGTTTTGG + Intronic
1127208941 15:56751310-56751332 TGGAATCTATAGATCAATTTGGG + Intronic
1127340210 15:58034055-58034077 TTGAATCTACATATTAACTTGGG + Intronic
1127407258 15:58663622-58663644 TTGAATCTACAAATCAATAAAGG + Intronic
1127697670 15:61467701-61467723 TTGAATGTATAGATCAATTTGGG - Intergenic
1128094266 15:64942085-64942107 TTTAATCCACACATCAACCTAGG - Intronic
1128230414 15:66030880-66030902 TTGAATCCTCAGACCAAGCCTGG - Intronic
1128339918 15:66814282-66814304 TTGAATCTATAGAACAAGTTGGG - Intergenic
1128406689 15:67348690-67348712 TTGAATTTATAGATCAATTTGGG - Intronic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1128584688 15:68838226-68838248 TTGAATCTATATATCAAATTGGG - Intronic
1128598874 15:68978290-68978312 TTAAATATATAGATCAATCTGGG + Intronic
1128803770 15:70515238-70515260 TGGAAGCTACAGTTCAAGATGGG - Intergenic
1128899342 15:71405711-71405733 TTGAATCTGTAGATCAATATGGG + Intronic
1129309796 15:74698821-74698843 TCGAATCTATAGATCAGGTTTGG + Intergenic
1129369471 15:75080284-75080306 TTAAATCTACTGATCAAGTTGGG - Intronic
1129613555 15:77080764-77080786 TTTAATCTACAGATAAAGCCTGG - Intronic
1130731832 15:86502009-86502031 TTGAAACTGTAGATCAATCTGGG + Intronic
1131088304 15:89597800-89597822 TAGAATCTATAGATCAAATTGGG + Intronic
1131320143 15:91381315-91381337 TTCAATTTACAGATCAAGTTGGG + Intergenic
1131919281 15:97305247-97305269 TTGAATCTATAGACCTAGTTTGG + Intergenic
1132108210 15:99080939-99080961 TTGATTCTATAGATCAATTTTGG - Intergenic
1132123010 15:99194177-99194199 TTGAATCTGGATATCAAGTTGGG - Intronic
1132134789 15:99325000-99325022 TTGAATCTGCAGATCAGTTTGGG + Intronic
1132165748 15:99587507-99587529 TTGAATCTATAGATCATTTTAGG + Intronic
1132174300 15:99697656-99697678 TTTAATCTACAGATCAATCTGGG - Intronic
1132614658 16:834428-834450 TTGAATCTGTAGATCAATTTGGG - Intergenic
1132730631 16:1359771-1359793 TTGAATCTGCAGATCACTCTGGG + Intronic
1133540310 16:6746186-6746208 TTGAATCTACAGATCAATTAGGG - Intronic
1133863626 16:9620577-9620599 TTGAATCTATAGATCAAATTAGG - Intergenic
1134140948 16:11718424-11718446 TTGTATGTACAGATCAAGGCTGG - Intronic
1134396461 16:13869122-13869144 TTGAGTCTATAGATCAAGCAAGG - Intergenic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1134534062 16:15010999-15011021 TTGAATCTACAGATTAGTTTGGG - Intronic
1135124181 16:19793593-19793615 TTGAATCTGTAGATCAATGTGGG - Intronic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1135466357 16:22689021-22689043 TTGAATCTATACATCAAGTTGGG + Intergenic
1135699924 16:24623456-24623478 ATGAGTCTGCAGATCAGGCTGGG + Intergenic
1135795558 16:25438420-25438442 TTAAATCTACAGATAAATTTGGG + Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1136601275 16:31291148-31291170 TTGAATCTGTAGATCAACCCAGG - Intronic
1136651346 16:31674375-31674397 TTGAATCTGCAGATCACATTTGG + Intergenic
1137248432 16:46724858-46724880 TTGAATCTATAGATCAATGGGGG + Intronic
1137379982 16:47988587-47988609 TTGAATCTATAGATCACTTTGGG - Intergenic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1138176602 16:54905222-54905244 TTGAATTTCTAGATCAAGTTGGG - Intergenic
1138355678 16:56378018-56378040 TTGAATCTGTACATCAAGTTGGG - Intronic
1138401879 16:56752576-56752598 TTGAATCTGCAGACCAATTTAGG - Intronic
1138591903 16:58004669-58004691 TTGAATCTGTAGATCAAATTGGG + Intronic
1138793498 16:59938912-59938934 TTGAATCTAGAGATCAAGTAGGG + Intergenic
1139069750 16:63365694-63365716 TTGAATCTGCAGAGCAAGGGAGG - Intergenic
1139121825 16:64028190-64028212 TTGAATCTATAGATCAAGCTGGG + Intergenic
1139370345 16:66464197-66464219 TTGAATCTTCAGATGAATTTGGG + Intronic
1139861973 16:70029727-70029749 TTGAATCTACAGATTAGTTTGGG + Intergenic
1140116404 16:72045439-72045461 TTGAATCTCCAGATCACTTTGGG - Intronic
1140693452 16:77507734-77507756 GTGAATCTAGAGATCAATTTGGG + Intergenic
1141037222 16:80638406-80638428 TTGAGTCTATAGATCAAGTTGGG - Intronic
1141194101 16:81846700-81846722 TTGAATCTATAGATGAAGCCAGG - Intronic
1141304433 16:82848230-82848252 TTGAAGCTATAGATAAAACTGGG + Intronic
1141549850 16:84798820-84798842 TTGACTCTATAGATCACTCTGGG - Intergenic
1142055373 16:87991463-87991485 TTGAATCTGTAGATCAATTTGGG + Intronic
1143254930 17:5549013-5549035 TTGAATCTATAGATCAGTTTGGG + Intronic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143469057 17:7160221-7160243 TTGAATTTATAGCTCAATCTAGG + Intergenic
1143917476 17:10304552-10304574 TTGAACTTACAGATCAAGTAAGG + Intronic
1143989892 17:10948323-10948345 TTGAATCTACAGATCAAGTTTGG + Intergenic
1144038271 17:11386687-11386709 TAGAATCTACAGCTCAGGCGGGG + Intronic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1144139050 17:12329695-12329717 TTTAAACTACAGATAAATCTGGG - Intergenic
1146341300 17:32021610-32021632 TTCAAACTACAGATCTAGATCGG + Exonic
1146554105 17:33808593-33808615 CTGAATCTATGGATCAAGTTGGG + Intronic
1146612227 17:34317741-34317763 TTGAAGGTACAGATCAAGTTGGG - Intergenic
1146732410 17:35204985-35205007 TTGAATCTGCAGGTCACGTTGGG + Intergenic
1146802344 17:35836189-35836211 GTGTGTCTACAGATCAAGTTGGG + Exonic
1146839694 17:36142155-36142177 TTGAATCTATAGATTAATTTGGG - Intergenic
1148247187 17:46040714-46040736 CTGACTCTACAGATCAATTTGGG + Intronic
1148893678 17:50827143-50827165 GTGAATCTATAGATCTAGTTGGG + Intergenic
1149508774 17:57219248-57219270 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1149679670 17:58496656-58496678 CTGAATCTACTGTTCCAGCTAGG + Intronic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1149977048 17:61276608-61276630 TTGAATCTGTAGATCAATTTGGG - Intronic
1150046564 17:61919216-61919238 TTGAGTTTAAAGATCAGGCTGGG - Intronic
1150312768 17:64142669-64142691 TTGAATCTGTAGATCAATTTGGG - Intergenic
1150461101 17:65353644-65353666 TTGAATCTACAGATCAGTTTAGG - Intergenic
1150480987 17:65510453-65510475 CTGAATCTATAGATCAATTTGGG - Intergenic
1150529937 17:65966900-65966922 TTGAATCTGTAGATCAATTTGGG - Intronic
1150548083 17:66183413-66183435 TTAAATCTACAGGTCAATTTGGG - Intronic
1152050716 17:77973908-77973930 TCAAATCTACAGATCAATCTAGG - Intergenic
1153036522 18:768342-768364 CTTAATCTATAGATCAATCTGGG + Intronic
1153503976 18:5776452-5776474 TTGTATCTGCAGATCAATTTAGG + Intergenic
1153751358 18:8234179-8234201 CTGAATCTATAGATCAATTTGGG + Intronic
1153873855 18:9347403-9347425 TTGAATCTGTAGATCAATTTGGG + Intronic
1154088488 18:11332188-11332210 TTGATTCTATAGCTCAAGTTGGG + Intergenic
1154232217 18:12567390-12567412 TTGAATCTGTAGATCAAGCTGGG - Intronic
1154282804 18:13021673-13021695 TTGAATCTACAGGTCACTTTGGG + Intronic
1154319392 18:13333968-13333990 TTGAATCTATTGATGAAGCTGGG + Intronic
1154948947 18:21189216-21189238 TTGAATCTACAGATCACTTTTGG + Intergenic
1154951320 18:21212893-21212915 ATGAATCTATAGATCAAGTTGGG + Intergenic
1155098297 18:22581459-22581481 TTGAATCTAAAAATCAATTTGGG + Intergenic
1155384012 18:25257317-25257339 TTTAATATAAATATCAAGCTAGG + Intronic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1155593153 18:27451877-27451899 TTAAATCTATAGACCAAGTTGGG + Intergenic
1155665338 18:28300838-28300860 CAGAATCTATAGATCAAGATGGG - Intergenic
1155690218 18:28612105-28612127 TAGAATCTATAGCTCAAGTTAGG - Intergenic
1155766370 18:29638497-29638519 TTCAATCTATAGATGAAGATGGG + Intergenic
1156052013 18:32948265-32948287 TTGAATCTTTAGATCAATTTGGG + Intronic
1156244733 18:35287239-35287261 TTGAATCTGTAGATCAATATGGG - Intronic
1156259750 18:35434297-35434319 TTGAATCTATAGGTCAATTTGGG + Intergenic
1156400938 18:36739531-36739553 TTAAATCTATAGATCAATTTTGG + Intronic
1156559758 18:38110221-38110243 TTGAATCTATAGACAAATCTGGG - Intergenic
1156607416 18:38682020-38682042 ATGAATCTATAGATCAAACTGGG - Intergenic
1156699678 18:39810511-39810533 TTGAATCTATAAATCACTCTGGG + Intergenic
1156813844 18:41284781-41284803 TTGAATCTATAGATTAAGTTGGG - Intergenic
1157244819 18:46044062-46044084 TTGGATCTATAGATCAATTTGGG - Intronic
1157275258 18:46305752-46305774 TTGGATCTATAGATCAATCTGGG + Intergenic
1157343156 18:46798401-46798423 TTGATTCTATAGATCAAGTTGGG - Intergenic
1157400940 18:47386693-47386715 TTGAATCTGTAGATCACCCTGGG - Intergenic
1157509324 18:48258613-48258635 TTGAATCTACAGATCAATTTGGG - Intronic
1157707822 18:49822316-49822338 TTTAATCTATAGATCAACTTGGG + Intronic
1157845174 18:50997153-50997175 TTGAAACTACAGATAAATTTAGG - Intronic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1158030374 18:52956664-52956686 TGGACTCTATAGATCAAGTTGGG + Intronic
1158261892 18:55615149-55615171 TTGAATCTATAGATTAATTTGGG + Intronic
1158290999 18:55942820-55942842 TTGAATCTATTGATCAAACTGGG + Intergenic
1158486713 18:57873759-57873781 TTGAATCTGTAGATCAATTTAGG - Intergenic
1158701036 18:59747007-59747029 TTGAATCTATAGATGAAGATAGG + Intergenic
1158783613 18:60681820-60681842 TTGAATCTGTAGATCAAATTAGG - Intergenic
1159173414 18:64802729-64802751 TTAAATTTATAGCTCAAGCTGGG - Intergenic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1159998144 18:74987875-74987897 TTGAATCTATAGATCAATGTGGG - Intronic
1160056384 18:75485569-75485591 TTGAATCTAAAGATCAAATTAGG - Intergenic
1160058411 18:75507863-75507885 TTGAGCCTACAGGTCACGCTGGG + Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1160536229 18:79595257-79595279 TTGAATCTATAGATCAAATTGGG - Intergenic
1160570199 18:79811153-79811175 TTGAATCTATAGATCAGTTTGGG - Intergenic
1160627561 18:80222422-80222444 TTGAATCTGTAGATCAATTTGGG - Intronic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1161881971 19:6961447-6961469 TTGGATCTATAGATCAAGTTGGG + Intergenic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1163379134 19:16952791-16952813 TTGAATCTATAGATCACTTTGGG - Intronic
1164066049 19:21718263-21718285 TAGAATCAACAGTTCAGGCTGGG + Intergenic
1164547907 19:29184290-29184312 TTGAATTTCCAGATCCTGCTGGG + Intergenic
1164815529 19:31198851-31198873 CTGAGTCTATAGATCAAGTTGGG - Intergenic
1164887298 19:31791870-31791892 TTGAATCAATAGATCAATTTGGG - Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164962747 19:32449346-32449368 TTGAATCTGTAGATCAATTTGGG - Intronic
1165250480 19:34529388-34529410 TTGAATCTGCAGATCATTTTTGG + Intergenic
1165264828 19:34651703-34651725 TTGAATCTGCAGATCACTTTTGG - Intronic
1165271926 19:34716337-34716359 TTGAATCTGCAGATCACTTTTGG - Intergenic
1165343865 19:35231362-35231384 TTGAATCTAAAGATAAATTTGGG - Intergenic
1165638072 19:37360502-37360524 TTGAATCTGCAGATAAATTTTGG + Intronic
1166138890 19:40794949-40794971 CTTGATCTACAGATCAAGCCAGG - Intronic
1166578099 19:43864354-43864376 TTGAATCTTCATATCAATTTGGG - Intergenic
1166910509 19:46151938-46151960 TTGATTCTATAGATCAATTTGGG + Intronic
1166922997 19:46244243-46244265 TTGAATATATAGATCAATTTGGG - Intergenic
1167398393 19:49247093-49247115 TTGAATCTGTAGATCAATTTGGG + Intergenic
1168698721 19:58421875-58421897 TTGAATCTGCAAATCAACTTTGG - Intergenic
925113571 2:1356735-1356757 TTGAATCTATAGATCACTTTGGG + Intronic
925145172 2:1577817-1577839 TTGAATCTATAAATCAATTTCGG - Intergenic
925335112 2:3092416-3092438 TTGAATCTGCAGATCACTTTGGG - Intergenic
925335214 2:3093742-3093764 TTAAACCTACAGATCAATTTGGG + Intergenic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
926783316 2:16495676-16495698 TTGAAGATGCAGATCAAGCATGG - Intergenic
926873052 2:17444645-17444667 TTTAATCTACAGAGCAATTTAGG - Intergenic
926887047 2:17607360-17607382 TTGTATCTCCAGATCAAAGTAGG - Intronic
927014163 2:18939349-18939371 TTGAATCTACAGGTCATTTTGGG + Intergenic
927362934 2:22257817-22257839 TTGAATCTAAAGGTCAAATTGGG + Intergenic
927573989 2:24185531-24185553 TTGAATCTGTAGATCAATTTGGG + Intronic
927728709 2:25450610-25450632 TTAAATCTATAGATCAATTTAGG + Intronic
927736606 2:25528964-25528986 CTGAATCTAAAGATCAAATTGGG - Intronic
927747616 2:25635580-25635602 TTGAATCTGTAAATCAAGTTGGG - Intronic
928050097 2:27983524-27983546 TGGGATCTACAGATCAACTTGGG + Intronic
928184699 2:29099760-29099782 CTAAATCTACAGATCACGCTGGG + Intronic
928191257 2:29171165-29171187 TTGACTATATAGATCAAGTTGGG + Intronic
928369086 2:30726785-30726807 TTAAATCTAAAGGTCAATCTGGG - Intronic
928483835 2:31709647-31709669 TTGAATCTATAAATCAATTTGGG + Intergenic
928643839 2:33329946-33329968 TTGAATCAATAGATCAATTTGGG + Intronic
928851164 2:35748909-35748931 TTGAATCTGTAGATCAATTTGGG - Intergenic
929072045 2:38040785-38040807 TTAAATCTACAGATCAGGTTAGG + Intronic
929301947 2:40314570-40314592 TTGAATCTCTAGATCAATTTGGG + Intronic
929463207 2:42120890-42120912 TTGAATCTACAGATCTATTAGGG + Intergenic
929491712 2:42402951-42402973 TTGAATTTATAGATCAATTTGGG + Intronic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
929900367 2:45995932-45995954 TTGAATATATAGATCGAGTTTGG + Intronic
929906718 2:46052569-46052591 TTGAATGTAGAGATCAATTTGGG - Intronic
929952260 2:46422363-46422385 TTGAATCTATAGATCAGTTTTGG - Intergenic
930331541 2:49991665-49991687 TTGAAGCTATAAATCAAGTTGGG - Intronic
930450424 2:51529363-51529385 TTGAATCAATAGATCAATTTAGG + Intergenic
930537531 2:52662846-52662868 TTGAATCTATAGATAAATTTTGG - Intergenic
930567871 2:53045899-53045921 TTGAATCTATAGATCACTTTGGG + Intergenic
930790720 2:55325132-55325154 TTGAATCAAGAGATCAATCTGGG + Intronic
930810984 2:55540657-55540679 TTGAATCTGTAGATCATGTTGGG + Intronic
930859791 2:56059479-56059501 TTGAATCTATAGATCACCTTGGG + Intergenic
930875853 2:56214938-56214960 TTGAACCTACAGATCAAGTTGGG + Intronic
930977720 2:57484341-57484363 TTGAATCTGTAGATCAAGTTGGG + Intergenic
931489656 2:62730987-62731009 TTGAGTCTATAGATCAAATTGGG + Intronic
931598235 2:63974507-63974529 TTGACTCTATTGATCAAGTTGGG + Intronic
931865216 2:66402588-66402610 TTGATTTTACAGATTAAGTTGGG - Intergenic
931865517 2:66406318-66406340 TTGAATCTATAGATTAACTTGGG - Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
931993414 2:67814489-67814511 TTGAATATATAGATCAATTTAGG - Intergenic
932189521 2:69728925-69728947 TTGAATTTATAGATCAATTTGGG + Intronic
932465308 2:71918918-71918940 TTGAAACTATAGATCAATATGGG - Intergenic
932470840 2:71955149-71955171 TTGAATATATAGATCAAGTTGGG + Intergenic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
933015282 2:77116116-77116138 TTGACACTACAAATCAAGCAAGG - Intronic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933409031 2:81901614-81901636 TTGAATCTCTAGATTAAGTTGGG - Intergenic
933447085 2:82395091-82395113 TTGAATCTGTAGATCACTCTGGG + Intergenic
933661799 2:84933734-84933756 TTGAGTCTACAGATCAGGTTGGG - Intergenic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
933855388 2:86408943-86408965 TTGAATCTATAGATAAATTTGGG - Intergenic
934016003 2:87882659-87882681 TTGAATTTATAGATCAATTTGGG + Intergenic
934536118 2:95135158-95135180 TTGAATCTGTAGATCAATTTGGG + Intronic
934908297 2:98226007-98226029 ATAAACCTATAGATCAAGCTGGG - Intronic
934920328 2:98338872-98338894 TGGAATCAACAGATCAATTTTGG + Intronic
934992088 2:98929051-98929073 TTGAATCTGCAGCACTAGCTTGG - Intronic
935093559 2:99921055-99921077 TTGAATCTTTAGATCAATTTGGG - Intronic
935510695 2:103969518-103969540 TTGAATCCGCAGATCAAGTTGGG + Intergenic
935518612 2:104077348-104077370 TTAAATCTATAGATCAAGTTGGG + Intergenic
935531919 2:104243973-104243995 TTGAATCTATAGATCACTTTGGG - Intergenic
935750438 2:106228135-106228157 TTTGATCTACAGATTAAGTTGGG + Intergenic
935835359 2:107046133-107046155 TTGAATTTACAGATTAATTTGGG - Intergenic
935875944 2:107507847-107507869 TTGAATCTATAGAGCAAGTTGGG + Intergenic
935995981 2:108773595-108773617 TTAAATCTATAGATCAATTTCGG - Intronic
936005167 2:108880342-108880364 TTGTATCTATAGATCAAGTTGGG - Intronic
936120828 2:109742596-109742618 TTGGATCTACAGATTAAGTTGGG - Intergenic
936223869 2:110628877-110628899 TTGGATCTACAGATTAAGTTGGG + Intergenic
936268095 2:111026342-111026364 TTGCATCTATAGATCAATATGGG + Intronic
936498411 2:113044032-113044054 TTGGATCTACAGGTCAAGTTGGG + Intronic
936736834 2:115455390-115455412 TTGAATCTATAAATCAATTTGGG - Intronic
936772301 2:115928668-115928690 ATGAATCTACAGAACAAGTTGGG + Intergenic
936781027 2:116032759-116032781 CTGAATCTATAGATCAATTTTGG + Intergenic
936795574 2:116198960-116198982 TTGAATCTATAGGTCAAATTGGG + Intergenic
937135858 2:119551815-119551837 TTGAATCTGTAGATCAATTTGGG + Intronic
937178991 2:119972216-119972238 TTGAATCTCTAGATCAAATTGGG + Intronic
937226206 2:120371158-120371180 TTGAATGTGCAGAACAATCTGGG + Intergenic
937651419 2:124323564-124323586 TTGAATCTCCACCTCAGGCTAGG - Intronic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
937850646 2:126631277-126631299 TTGCATCTATAGTTCAAGTTGGG - Intergenic
937954409 2:127412930-127412952 TTGAATCTATAGAACAATTTAGG - Intergenic
937961243 2:127461151-127461173 TTGCATCTATAGATCAATTTGGG - Intronic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
938700077 2:133869405-133869427 TTGAATCTATAGATCACTTTGGG - Intergenic
939110112 2:137996595-137996617 TTGAATCTATAAATCAATTTGGG - Intronic
939144351 2:138394848-138394870 TTGATTCTATAGATCAAGTCAGG - Intergenic
939216816 2:139249272-139249294 TTGAATCTATAGATTACGTTGGG + Intergenic
939359588 2:141151741-141151763 CTGAGTCTAGACATCAAGCTTGG - Intronic
939802294 2:146724920-146724942 TTGAATTTATAGATCAAGTTGGG - Intergenic
939911979 2:147994280-147994302 TTGAATTTATAGATCAAGGTTGG - Intronic
940010122 2:149044194-149044216 TTAAATCTACAGATTAATTTAGG + Intronic
940309714 2:152265047-152265069 TTGAATCTATAGGTCAAATTTGG - Intergenic
940383106 2:153038727-153038749 TTGAATCTATAGATCATTTTAGG + Intergenic
940410155 2:153353019-153353041 TTGATTCTATAGATCAACTTAGG + Intergenic
940472908 2:154121393-154121415 TTGAATTTATAGATCAAGTTGGG + Intronic
940619312 2:156090930-156090952 TTGAAACTATAGATCAAGTTGGG + Intergenic
940620189 2:156102959-156102981 TTGAATCTGAAGATCAAGTTGGG - Intergenic
940644045 2:156371830-156371852 TTGAATCTACAAATTAACCTTGG + Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
940920484 2:159300189-159300211 TTGAATCTGTAGATCAACTTGGG + Intergenic
941034164 2:160548658-160548680 TTGAATCTACAGAGGAATTTTGG + Intergenic
941073581 2:160982302-160982324 TTGAATCTATAGATTACGTTGGG - Intergenic
941242594 2:163058088-163058110 TTGAGTCTATAGATCAAGTTAGG + Intergenic
941259632 2:163280904-163280926 TTCAATCTACAGACCAATTTGGG - Intergenic
941402859 2:165052969-165052991 TTGAATCTATACATCAAGCTGGG - Intergenic
941873988 2:170414647-170414669 TTAAATCTACAGATGAATTTAGG + Intronic
941958045 2:171224625-171224647 TTGAATCTGTAGATCAACTTGGG - Intronic
942180703 2:173377907-173377929 TTGAATCCTCATATCAAGATGGG - Intergenic
942235544 2:173900872-173900894 TTGAATCTATAGATTAATTTGGG - Intergenic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942405054 2:175645303-175645325 CTGAATCTATAGAGCAAGTTGGG + Intergenic
942493746 2:176517235-176517257 TTGAATCAATAGATCAATTTTGG + Intergenic
942532787 2:176930149-176930171 TTGAATTTACAAATCAATTTAGG - Intergenic
942744516 2:179216555-179216577 TTGAATCTATAAATTAACCTTGG - Intronic
942757076 2:179353999-179354021 TTGAATTTACAGATTAATTTAGG + Intergenic
942792917 2:179781069-179781091 TTGAATCTACAGATTAATTGGGG - Intronic
942887587 2:180945964-180945986 TTGAATGTATAGATCAATTTGGG + Intergenic
943148084 2:184071515-184071537 CTCAATATAAAGATCAAGCTTGG - Intergenic
943210662 2:184961659-184961681 TTGAATCTATAGATCCAGGTGGG + Intergenic
943277356 2:185884141-185884163 TTGAATCTATAAATTAAGTTGGG - Intergenic
943932673 2:193874535-193874557 GTGAATCTAAAGATCGAGTTGGG + Intergenic
943946747 2:194074876-194074898 TTGAATCTCCAGATTAAATTTGG + Intergenic
944045029 2:195401307-195401329 TTGAATCTATAGATCAATCTGGG - Intergenic
944158141 2:196630497-196630519 TTGAATCTAGAGATCACATTGGG - Intergenic
944640609 2:201721236-201721258 TTGAATCTATAGATTAATTTGGG - Intronic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
945021485 2:205576861-205576883 TTGAATCTGTAGATCAAGTTGGG + Intronic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945443610 2:209910058-209910080 TTGAAATTACACATCAAGCAGGG + Intronic
945475781 2:210280799-210280821 TTGAATCTATAGATCACTTTTGG + Intergenic
945669316 2:212784137-212784159 TTGAATCTGCAGATCACATTGGG - Intergenic
945674226 2:212835727-212835749 TTGAATCTATAGATGAAGTTAGG + Intergenic
945880854 2:215323372-215323394 TTGAATCTGTAGATCAATTTGGG + Intronic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
946389258 2:219405541-219405563 TTGAGGCCACAGATCAAGCCTGG + Intergenic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
947043887 2:225955044-225955066 TTGAATCTGTAGATCGAGTTGGG - Intergenic
947190269 2:227497247-227497269 TTCAATCTGCAGACCAAACTGGG - Intronic
947475229 2:230440620-230440642 TTGAAGCTACAGATAAATTTGGG - Intronic
947920735 2:233869636-233869658 TTGAATCTATAGATCAATTAGGG + Intergenic
948090512 2:235290320-235290342 TTGAATCTACAGATCAGCAGAGG - Intergenic
948267874 2:236649877-236649899 TTGAATCTATACATCAAAATGGG + Intergenic
948539355 2:238676459-238676481 TTGAATCTATGGATCACTCTTGG + Intergenic
948557985 2:238829308-238829330 TTAAATCTACAGATCATCTTGGG - Intergenic
948731362 2:239965882-239965904 TTGAATTTAGAGATCCAGCGAGG - Intronic
1168907097 20:1414731-1414753 TTGAACCTACAGATAAATTTGGG - Intergenic
1169032933 20:2426070-2426092 TTGAATCTATAGATCAAGCTAGG + Intronic
1169152438 20:3300254-3300276 CTGAACCTACAGATCATGTTGGG + Intronic
1169183046 20:3587795-3587817 TTGAATCTACTGACCAATTTGGG + Intronic
1169312567 20:4558233-4558255 TTGGATCTATAGATCAAGTCAGG - Intergenic
1169734124 20:8818966-8818988 TTTAATCTATAGATCAATTTGGG - Intronic
1170023053 20:11857186-11857208 TTGAATCTATAGATCTATTTAGG + Intergenic
1170054357 20:12183190-12183212 TTAAATCTGCAGATCAATATGGG + Intergenic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170778178 20:19398244-19398266 TTGAATCTATAGATCAAACTGGG + Intronic
1171319459 20:24228277-24228299 TTGAATCTATAGATCACCCTGGG - Intergenic
1171415338 20:24975597-24975619 TTGAATCTATAGATTAAGGTTGG - Intronic
1171432921 20:25096608-25096630 TTGAATCTATAGATTAAGTTAGG - Intergenic
1171949625 20:31409443-31409465 ATGAACCTAAAGAGCAAGCTGGG + Intronic
1172078844 20:32322075-32322097 TTGAATCTGTAGATCAATTTGGG + Intronic
1172089235 20:32416033-32416055 TTGAATCTACAAATCAAATTGGG - Intronic
1172089474 20:32418774-32418796 TTGAATCGACAAATCAAAATGGG + Intronic
1172130903 20:32654416-32654438 TTGAATCTGAAGATCAATTTGGG - Intergenic
1172349080 20:34227703-34227725 TTGAATCTATTGATAAACCTGGG - Intronic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1174084548 20:47997047-47997069 TTGAATCTGTTGATCAAGTTGGG + Intergenic
1175316429 20:58051122-58051144 TTGAATCTGCATATCAATTTGGG - Intergenic
1175317809 20:58063704-58063726 TTGAATCTACGGATCAACTTGGG - Intergenic
1175511423 20:59529488-59529510 TTGAATCTATAGACCAACTTAGG - Intergenic
1175855807 20:62120365-62120387 TAGAATGTACAGGTCAATCTTGG + Intergenic
1177000932 21:15612069-15612091 TTGAATCTATACACCAAGTTGGG - Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177256380 21:18668672-18668694 TTGATTCTAAAGATCAAATTAGG - Intergenic
1177304586 21:19296690-19296712 TTGAATCTACAAATTACTCTGGG - Intergenic
1177349581 21:19919423-19919445 TTGAATCTCTAGATCAAGTTGGG - Intergenic
1177468740 21:21526552-21526574 CTGACTCTACAGATCAAGTTGGG - Intronic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1177843504 21:26261186-26261208 TTGAATCTATAGATCAGTTTGGG + Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1178483317 21:32999506-32999528 TGGAATCTATAGATCAATTTGGG - Intergenic
1179018131 21:37612423-37612445 TTTAATCTACAGAGGAAGCTGGG - Exonic
1180124483 21:45779777-45779799 TTGATTCTATAGATCAACATGGG - Intronic
1180486739 22:15807956-15807978 TTGAATCTATAGATCAAGAAGGG + Intergenic
1180579593 22:16819210-16819232 TCAAATATATAGATCAAGCTGGG - Intronic
1181713954 22:24710654-24710676 TTGAATCTAGAGATCACTTTAGG - Intergenic
1182054740 22:27342093-27342115 TTGAATCCATAGATCAATTTAGG + Intergenic
1182142289 22:27970971-27970993 TTGAATCTATAAATCAATTTGGG + Intergenic
1182274665 22:29179603-29179625 TTAAAGCTACAAAACAAGCTGGG + Intergenic
1182400491 22:30072779-30072801 TTGAATCTGTAGATCAATTTGGG - Intergenic
1182407338 22:30147110-30147132 TTGAATGTATAGATCAATTTGGG - Intronic
1182581613 22:31316198-31316220 TTTGATCTATAGATCAAGTTGGG - Intergenic
1182607587 22:31518323-31518345 TTGAATCTATAGATCAGAGTGGG + Intronic
1182797258 22:33000068-33000090 TCAAATCTACAGATGAGGCTGGG + Intronic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1183133288 22:35860752-35860774 CTGAATCTACAGATCACTTTGGG + Intronic
1183257242 22:36770483-36770505 TTGGATATACAGACAAAGCTTGG - Intronic
1183694159 22:39410776-39410798 TTAAATCTACAGATCAATTTGGG - Intronic
1183766728 22:39884121-39884143 TTGAATCTGTAGATCAATTTGGG - Intronic
1184509250 22:44922891-44922913 TTGAATCTGTAGATCAATCTGGG - Intronic
1184621284 22:45680397-45680419 TTGAATCCACAGGTCAATTTGGG - Intronic
1184623149 22:45698524-45698546 TTGAATCTATAGATCAATTGGGG + Intronic
1184752338 22:46494403-46494425 CTGAATCTACAGACCAGTCTGGG + Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
1185350589 22:50335005-50335027 TTGGATCCACAGATCAATTTGGG + Intergenic
1185424625 22:50759744-50759766 TTGAATTTGCAGATCAATTTGGG + Intergenic
949196080 3:1309698-1309720 TTAAATCTATTGATCAAGTTGGG + Intronic
949292227 3:2480680-2480702 TCGAATCTATAGATCAAGTTGGG - Intronic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949870667 3:8585159-8585181 TTGAATCAACAGGTCAATTTGGG + Intergenic
949870746 3:8586122-8586144 TGGAATCAACAGATCAATTTGGG + Intergenic
949915267 3:8957247-8957269 TTGAATCTAGAGATCAATTTGGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950337496 3:12208838-12208860 TTTAATCTAAAGATCAATTTGGG + Intergenic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950735074 3:15000738-15000760 TTGAATCTTTAGATCAATTTGGG + Intronic
950828327 3:15849223-15849245 TTGAATCAATAGATCAATTTGGG - Intronic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
950959115 3:17085986-17086008 TTGAATCTATATATCAAGTTGGG - Intronic
950994137 3:17476662-17476684 CTGAATCTATAGATCAATTTGGG + Intronic
951200496 3:19871676-19871698 TTGAATCTAAAGATCAGTTTGGG - Intergenic
951265920 3:20566657-20566679 TTGAATCTATAAATCAAGTTGGG + Intergenic
951376932 3:21929874-21929896 TTAAATCTATAGATCAATTTGGG - Intronic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
951662340 3:25082930-25082952 TTGGATATACAGCTCCAGCTTGG + Intergenic
951974078 3:28483551-28483573 TTGAATTTATATATCAAGTTGGG + Intronic
952128135 3:30327149-30327171 TTGAATCTATACATCAAGTTGGG - Intergenic
952131413 3:30368213-30368235 TTTAGTCTACAGATCAGGTTGGG + Intergenic
952426239 3:33177292-33177314 TTCAATCTATAGATCAAGTTGGG + Intronic
952473262 3:33678842-33678864 TTGAATCCATAGATCAAGTTGGG - Intronic
952559222 3:34570293-34570315 TTGAATCTACAGGTCAATTTGGG + Intergenic
952611395 3:35215016-35215038 TTGAATCTATAGATAAACTTGGG + Intergenic
952635967 3:35531803-35531825 CTGAATCTACAGATCATTTTGGG - Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
953037083 3:39221814-39221836 TTGAATCTATAGATCAGTTTGGG - Intergenic
953192778 3:40703727-40703749 TTGACTCTATAGATCAAGTTGGG + Intergenic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953501687 3:43442618-43442640 TTGAATCTATAGATCACTTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
953870550 3:46622931-46622953 TTGAATCTATAGGTCAATTTAGG + Intronic
954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG + Intronic
955051927 3:55420599-55420621 TTTAATCTATAGATCAACCTGGG - Intergenic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
955262881 3:57411754-57411776 TTGAATCTACATGTCAAGTTTGG - Intronic
955667107 3:61361922-61361944 TTGAATCTGTAGATCAATTTGGG - Intergenic
956339017 3:68199427-68199449 TTGAAATTATAGATCAAGCTGGG + Intronic
956396942 3:68836035-68836057 TGAAATCCACAGATCTAGCTGGG - Intronic
956628420 3:71290024-71290046 CTGAATTTATAGACCAAGCTAGG + Intronic
956993686 3:74798765-74798787 TTGAATCTATAAATTAAGTTGGG - Intergenic
957037200 3:75304929-75304951 TTGAATCTACAGATCAATTTGGG + Intergenic
957120885 3:76090521-76090543 TTGAAACTATAGATCAACTTTGG - Intronic
957400440 3:79705744-79705766 CTGAATCTATAGAACAAGTTGGG + Intronic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958086801 3:88819852-88819874 TCGAGTCTACAGATAAAGTTGGG + Intergenic
958443724 3:94189085-94189107 TTGAATCTATAGACCAAGTTGGG + Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
958628007 3:96651043-96651065 TTGAATCTAGAGATCAGTATAGG + Intergenic
958653284 3:96966193-96966215 TTGAATTTATAGATAAAACTGGG + Intronic
959004131 3:100999928-100999950 TTGAATCTATGGATCAATCTGGG + Intergenic
959114329 3:102157962-102157984 TTAAAACTACATATCAAGGTGGG - Intronic
959402212 3:105916613-105916635 TTGAATCTATAGATCACTTTGGG + Intergenic
959428802 3:106225756-106225778 TTGACTCTACAGATTAATTTGGG + Intergenic
959485045 3:106918543-106918565 CTGAATCTATAAGTCAAGCTGGG + Intergenic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959561330 3:107786241-107786263 TTGAATCTGTAGATCAATTTGGG - Intronic
959666572 3:108929004-108929026 TTGAATCTACAGATCAACTTGGG + Intronic
959728822 3:109576791-109576813 TTGACTCTATAGATCAATTTGGG - Intergenic
960020370 3:112945146-112945168 TTGAATACATAGATCAAGTTGGG - Intronic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960227073 3:115181041-115181063 TTGAATCTACAGATCAAGTCAGG - Intergenic
960547321 3:118930806-118930828 CTGAATCTATAGATCAATTTAGG - Intronic
960652736 3:119969422-119969444 TTGAATTTGCAGATCAAGTTGGG - Intronic
960678570 3:120222688-120222710 TTGAACCTATATATCAATCTGGG + Intronic
960760188 3:121064508-121064530 TTGAATCTATAGATCATTTTCGG + Intronic
960813589 3:121650244-121650266 TTGAATCTATAGATCATTTTAGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
960893281 3:122474273-122474295 TTGAATCTATAGGTCTAGTTGGG - Intronic
960900112 3:122545884-122545906 TTCAATTTACAGACCAAGTTTGG - Intronic
960982898 3:123248656-123248678 TTGAATCTATAGACCAAGTTGGG - Intronic
961025756 3:123555654-123555676 TTGAATCTATAGAGCAAGTCGGG - Intronic
961579579 3:127868826-127868848 TTAAATCTATAGATCAATCTGGG + Intergenic
961914790 3:130362694-130362716 TTAAATCTACAGATCAATTTGGG + Intronic
962194322 3:133347202-133347224 TTGAATCTGTAGATCAAGTTGGG + Intronic
962290476 3:134132142-134132164 ATGAATCTAGAGATCAAATTGGG - Intronic
962326386 3:134436715-134436737 TTACATCTACAGATCAATTTGGG + Intergenic
962717981 3:138144125-138144147 TTGAATCTATAGACCAAATTGGG - Intergenic
962824063 3:139082897-139082919 TTGAAACTATAGATCAGGTTGGG + Intronic
963014992 3:140814744-140814766 TTGAATTTATAGATCAAGCTGGG - Intergenic
963120455 3:141772041-141772063 TTGAAGCTAAAGAACAACCTGGG + Intergenic
963377545 3:144488069-144488091 TTGAGTCTGTAGATCAAGTTGGG + Intergenic
963406853 3:144876257-144876279 TTGAATCTACAGATCACTTTTGG + Intergenic
963514073 3:146286295-146286317 TTGTATCTATAGATCAATTTGGG + Intergenic
963588498 3:147226448-147226470 TTAAATCTATAGATCAGGCTGGG + Intergenic
963823878 3:149930392-149930414 TTGAATTTATAAATCAAGTTGGG + Intronic
963859132 3:150289223-150289245 TTGAATCTGTAGATCAACTTGGG - Intergenic
964174837 3:153815128-153815150 TTAAATCTAAAGATCAATTTGGG - Intergenic
964264902 3:154884142-154884164 TTAAATCTATAGACCAAGTTGGG - Intergenic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
965326527 3:167310917-167310939 ATGAATCTATAGATCAAGTTGGG - Intronic
965447181 3:168789438-168789460 TTGAATCTGCAGATTAATTTGGG - Intergenic
965848922 3:172998104-172998126 TTGAATCTATGGATCAAGTTTGG + Intronic
966131542 3:176646228-176646250 TTAAATCTATAGATCAAGTTGGG - Intergenic
966178445 3:177165417-177165439 TTGAATTTGTAGATCAAGTTGGG - Intronic
966275684 3:178164552-178164574 TTGAATCTATAGATAAAATTTGG - Intergenic
966531161 3:180981976-180981998 TTATCTCTACAGATCTAGCTTGG - Exonic
966844279 3:184115168-184115190 TTGAATCTGTAGATCAATTTGGG - Intergenic
967456861 3:189697619-189697641 TTGAATGTATACATCAAGTTGGG + Intronic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
967560614 3:190914206-190914228 TTGAATCTATAGATCGCGTTTGG + Intergenic
968165122 3:196458696-196458718 TTTAATAGACAGATCAGGCTGGG + Intergenic
968444221 4:641103-641125 TTAAATCTGTAGATCAAGTTGGG + Intronic
968535130 4:1121549-1121571 TTGAATCTATAGAACAAGTTGGG - Intergenic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
968842637 4:3018966-3018988 TTTAATCTACAGATCAATTAGGG - Intronic
968851321 4:3081152-3081174 TTGAATCTGTAGATCAACTTGGG + Intronic
969062194 4:4445756-4445778 TTGAATTTATAGATCAATTTGGG - Intronic
969625164 4:8299051-8299073 TTGAATTTACAGATCAATTTGGG + Intronic
969708340 4:8827498-8827520 TTGAGTCTATAGATCAAGTGAGG - Intergenic
969942186 4:10744430-10744452 TTGAATCTGTAGATCAATTTTGG - Intergenic
970482563 4:16492070-16492092 TTGAATCTGTAGATCAAATTGGG - Intergenic
970534470 4:17015799-17015821 TTGAATCTACAGATCAATATGGG + Intergenic
971432844 4:26586528-26586550 TTGAATCTGTAGATCAATTTGGG + Intronic
971491867 4:27220962-27220984 TTGAATCTATAGATCACTTTGGG + Intergenic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
971804979 4:31345503-31345525 TTGAATCTATAGATCAATTAGGG - Intergenic
972618558 4:40723736-40723758 TTAAAACTACAGGTCAGGCTGGG - Intergenic
972830089 4:42804522-42804544 TTGAATCTACAGATCAAATTGGG + Intergenic
972920060 4:43927823-43927845 TTGAACCTAGAGATCAATTTGGG - Intergenic
972997522 4:44899609-44899631 TTGAATCTGTAGATCAATTTGGG + Intergenic
973135086 4:46697134-46697156 TTGGATCTATATAACAAGCTGGG + Intergenic
973226869 4:47795349-47795371 TTGAATCTATAGATCACTCTGGG + Intronic
973313819 4:48738840-48738862 TTGACCCTATAGATCAAGTTGGG - Intronic
973977540 4:56278080-56278102 TTGAATCTGTAGCTCAATCTGGG - Intronic
973986358 4:56357914-56357936 TTTAATTTACAGATCAATTTGGG + Intronic
974104174 4:57449171-57449193 TTGAATCTGCAGATCACTTTGGG + Intergenic
974170238 4:58257524-58257546 TTGAATTTATAGATCAAGTTGGG - Intergenic
974475012 4:62367291-62367313 TTGAATCTACAGATCAAATTGGG - Intergenic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
974854908 4:67449358-67449380 TTGAATCTGTAGATTAAGTTGGG - Intergenic
974883501 4:67787630-67787652 TTGAAACTTCAGATCAAAGTAGG - Intergenic
975337110 4:73190986-73191008 TTGAATTTACAGATTAATTTGGG - Intronic
975688436 4:76941732-76941754 TTGAATCTGTAGATCAATTTAGG + Intergenic
975958394 4:79870276-79870298 TTGAAGCTATAGATCAAGTTGGG - Intergenic
975996024 4:80316652-80316674 TTGAATCTATAAATCAATTTGGG - Intronic
976060301 4:81119946-81119968 TTGAATTTATAGATCAAGTTGGG + Intronic
976136394 4:81941671-81941693 TTGAATCTATAGATCAGTTTGGG - Intronic
976346451 4:84008377-84008399 TTGACTCTACAGATCAAGTGGGG + Intergenic
977133853 4:93276500-93276522 TTGAATCTGTAGATCAATTTGGG + Intronic
977152944 4:93536129-93536151 TTGAATCTATAGATCCCTCTGGG - Intronic
977428815 4:96904997-96905019 TTGAAACTACAGATTAAACTGGG - Intergenic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
977488726 4:97684169-97684191 TTGTATCTATAGATCAAATTGGG - Intronic
977746312 4:100551707-100551729 TTAAATCTATAGATCAAGCATGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977953168 4:102997247-102997269 TTGAATCTATAGATTAATTTGGG + Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978156744 4:105498236-105498258 TTCAATCTATAGATCAATTTGGG - Intergenic
978213563 4:106169137-106169159 TTGAATCTACATATCAATTTGGG - Intronic
978415481 4:108471144-108471166 TTGAATCCATAGATCAAGTTGGG - Intergenic
978475267 4:109121025-109121047 TTGAATCTATAGATTAAGATGGG - Intronic
978481893 4:109202045-109202067 TTGAACCTATAAATCAAGTTGGG - Intronic
978665763 4:111179441-111179463 TTGAATCTAAAGACCAAGTTTGG + Intergenic
978948881 4:114532747-114532769 TTGAATATATAGATCAATTTGGG - Intergenic
979025108 4:115560971-115560993 TTGAATCTATACATCAATGTGGG + Intergenic
979071267 4:116209867-116209889 TTGAATCTGTAGATCAAGATGGG - Intergenic
979116245 4:116827867-116827889 TTAAATCTGCAGATCAACTTAGG - Intergenic
979410416 4:120371387-120371409 TTTAGTCTACAGATAATGCTTGG + Intergenic
979749906 4:124266370-124266392 TTGAATCTACAAATCAATTTGGG - Intergenic
979903360 4:126252265-126252287 TTGAACCTATAGATCAAGTTGGG - Intergenic
979952594 4:126912718-126912740 TTGAATCTATAAATCAAGTTGGG - Intergenic
979995971 4:127431469-127431491 TTGAATCTGTAGATCAACATGGG - Intergenic
980584798 4:134797922-134797944 TTAAATCTACAGATCAAATTGGG - Intergenic
981052584 4:140324757-140324779 TGGAATCTACAGATCAAACTGGG - Intronic
981396583 4:144256759-144256781 TTAGATCTACAGATCAATTTAGG + Intergenic
981868143 4:149452267-149452289 TTGAATCTGTAGATCAATTTGGG - Intergenic
981968687 4:150638013-150638035 TTGAATCTATAGATCAGTTTGGG + Intronic
982079442 4:151773681-151773703 TTGAATCTATAGATTAATTTGGG + Intergenic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982161176 4:152571060-152571082 CAGAATCTATAGATCAAGTTGGG + Intergenic
982250855 4:153405063-153405085 TTGAATCTGTAGATCAATTTGGG - Intronic
982282611 4:153700501-153700523 TTGAATCTATAGAACAATTTGGG - Intergenic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982566053 4:156988226-156988248 TTAAATCTACAGATCAATTTGGG + Intergenic
982588818 4:157278042-157278064 TTGAATCTATAAATCAAGTTGGG - Intronic
982799198 4:159682096-159682118 TTGAATCTATAGACTAAGTTGGG - Intergenic
982895416 4:160916100-160916122 CTGATTCTATAGATCAAGTTGGG + Intergenic
982984604 4:162190404-162190426 TTGAATCTATAGATCATCTTGGG + Intergenic
983093279 4:163532021-163532043 TTGAATCTGTAGATCAAACTGGG - Intronic
983161059 4:164414863-164414885 TTGAATTTACAGGTCAATTTTGG - Intergenic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983562832 4:169118096-169118118 CTTCATCTACAGAACAAGCTAGG + Intronic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
984003401 4:174279429-174279451 TTGAATCTATAGATCACTTTGGG - Intronic
984259027 4:177422165-177422187 TTGAATCTGCAGGTCAAGTTGGG + Intergenic
984313557 4:178096653-178096675 TTGAATCTGTAGATCAGGTTGGG - Intergenic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
984636632 4:182117856-182117878 TTGAATCTGTAGATCAAGTTGGG + Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985516757 5:350180-350202 TTGAATCTATAGATCAGTTTTGG + Intronic
985527076 5:410585-410607 TTATATCTACAGATCAATTTAGG + Intronic
985728624 5:1529674-1529696 TTGAATCTATTGATCAATTTGGG + Intergenic
985759647 5:1739661-1739683 TTGAATCTACAGATCAATTTGGG + Intergenic
985851908 5:2394710-2394732 TTGTATCTAAAGACGAAGCTGGG + Intergenic
986021726 5:3810728-3810750 TTGAATCTATAAATCAAACTGGG - Intergenic
986119063 5:4813794-4813816 TTGAATTTACACATCAAGCTGGG + Intergenic
986211130 5:5673546-5673568 TTGAATCTACAAAGCAATGTAGG - Intergenic
986344913 5:6825819-6825841 TCGAATATGCAGATCAAGTTTGG + Intergenic
986356459 5:6932636-6932658 TTGAATCTAAAGATAAATTTGGG + Intergenic
987551700 5:19390962-19390984 TTGAATCTACAGATTAATTAAGG - Intergenic
987689654 5:21250674-21250696 TTGAATCTACAGATCACTTTGGG + Intergenic
987997258 5:25299902-25299924 TTGAATCTATAGACCAAATTGGG + Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988186991 5:27877844-27877866 ATGAATCTATAGATCAAGTTGGG + Intergenic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
988819820 5:34871476-34871498 TTAAATCTGCAGATCAATCTTGG - Intronic
988935724 5:36080878-36080900 TTGAATCTAGACATCAATTTGGG + Intergenic
988937288 5:36097627-36097649 TTGAACCTATAGATCAATTTGGG + Intergenic
989288689 5:39735423-39735445 TTGAATCTATAGATTAAGTTGGG + Intergenic
989416829 5:41188204-41188226 TTGAATCTATAAATCAATTTGGG - Intronic
989776717 5:45217628-45217650 TTGGATCTATAGATCAAGTCAGG - Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990142072 5:52716826-52716848 TTTAATCTACAGATCAAGCTGGG + Intergenic
990231784 5:53720532-53720554 TTGAATCTACAGATTACTTTGGG - Intergenic
990326684 5:54683689-54683711 TTGAATCTACAGATCAAGTAAGG + Intergenic
990585689 5:57208562-57208584 TTGAATCTGTAGATCATGTTTGG + Intronic
991008082 5:61851220-61851242 TTGAATTTATAGATCAAATTGGG - Intergenic
991119146 5:62991077-62991099 TTGAATCTGTAGATCAAGTTGGG + Intergenic
991125535 5:63065844-63065866 TTTAATCTACAGACACAGCTGGG - Intergenic
991310768 5:65238862-65238884 TTGAATCTATAGATCAATTGAGG - Intronic
991647254 5:68813117-68813139 TTGAGTATACAGATCAAGTTGGG + Intergenic
992011833 5:72535685-72535707 TTGAATCTATACATCAATTTGGG - Intergenic
992161001 5:74001631-74001653 TTGAATCTATAGACCAATTTGGG + Intergenic
992180407 5:74191194-74191216 TTGAATCTATAAGTCAAGTTGGG + Intergenic
992264001 5:74999620-74999642 TTGAACATACAGATTAAGTTGGG + Intergenic
992276644 5:75127697-75127719 CTGAATCTATAGATCAATTTGGG + Intronic
992406751 5:76465950-76465972 TTGAATCTATAAATCAATTTGGG - Intronic
992411170 5:76506941-76506963 TTGGACCTATAGATCAAGTTGGG - Intronic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992533653 5:77676186-77676208 CTGACTCTACAGATCAAGTTGGG - Intergenic
992544686 5:77801062-77801084 TTGAATCTATGGATCAAGTTAGG - Intronic
992601074 5:78400433-78400455 TTGAATCTGTAGATCAAGTTGGG + Intronic
992694269 5:79269503-79269525 TTGAATTTATAGATCAAGTTAGG + Intronic
993172856 5:84442478-84442500 TTGAATTTATAGATAAAGATGGG - Intergenic
993588747 5:89766757-89766779 TTGAATCTACAGATCAATGTGGG + Intergenic
993785610 5:92131189-92131211 TTGGATCTATAGATCAATTTGGG + Intergenic
994238977 5:97398182-97398204 TTTAATCTATAGATCAAATTGGG + Intergenic
994281246 5:97905466-97905488 TTGAATCTACAGATTGATTTGGG - Intergenic
994301226 5:98150251-98150273 TTGAATCTATAGAGCAAATTGGG + Intergenic
994346117 5:98688839-98688861 TTGAATCTATAGATCACTTTGGG - Intergenic
994441062 5:99803294-99803316 TTGAATCTGCAGATCACTTTGGG - Intergenic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
994864564 5:105250227-105250249 TTGTATCTACAGATCACTTTGGG - Intergenic
995285344 5:110382309-110382331 TTAAATCTATAGATCAAGTTGGG + Intronic
995671916 5:114614586-114614608 TGGAATCTATAGATCACGTTGGG - Intergenic
995745715 5:115400772-115400794 TTGAATCTATAGATCACTTTGGG + Intergenic
995882271 5:116856423-116856445 TTGAATCAATAGATTAATCTGGG - Intergenic
996120695 5:119668420-119668442 TTGAATCTATAAATTAAGTTGGG + Intergenic
996345402 5:122483296-122483318 TTGAAGTTACAGATCAATTTGGG - Intergenic
996433701 5:123410267-123410289 TTGAATCTGTAGATCAAATTAGG - Intronic
996592897 5:125167779-125167801 TTGAATCTGTAGATCAAGTTGGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
997156729 5:131569149-131569171 TTGAATCTATAGATTAATTTGGG - Intronic
997168780 5:131692477-131692499 TTGAATCTATGGATCAACTTGGG - Intronic
997314238 5:132918803-132918825 TTGGATCTATAGATCAATTTGGG - Intronic
997703819 5:135928731-135928753 TTGAATCTAGAAATCAACTTAGG - Intronic
997707383 5:135969665-135969687 TTGAATCTGTAGATCAATTTAGG + Intergenic
997857578 5:137386295-137386317 TTAAATCTCCAGATCAAGTTGGG - Intronic
998178823 5:139921170-139921192 TTGAATCGATAGATCAAGTTGGG - Intronic
998686080 5:144527871-144527893 TTGAATCTATAGATCATGCTAGG - Intergenic
998962135 5:147499630-147499652 TCGAATCTAAAGATCAAGTTGGG - Intronic
999000523 5:147917164-147917186 TTGAATCTATAGATCACATTAGG - Intergenic
999315558 5:150581615-150581637 TTGAATCTGTAGATCAATTTTGG - Intergenic
999564765 5:152845922-152845944 TTGAATTTGTAGATCAAGTTGGG + Intergenic
999573855 5:152951716-152951738 TTGAATCTATAGATCACTTTGGG - Intergenic
999688788 5:154127094-154127116 TTGAATCTACAAATTACCCTGGG - Intronic
1000013102 5:157252053-157252075 TTGAATCTATAAGTCAAGTTGGG + Intronic
1000054094 5:157588671-157588693 TTAATTCTACAGATCAAGTTAGG + Intergenic
1000061528 5:157660872-157660894 TTGAATCTATGGATCAATTTTGG + Intronic
1000066915 5:157701311-157701333 TTGAATCTATGGATCAATTTTGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000277447 5:159750800-159750822 TTGAATCTAAAAATAAAGTTAGG + Intergenic
1000405225 5:160880370-160880392 TTGAACCTATAGATCAAGTTTGG - Intergenic
1000465804 5:161574738-161574760 TGGAATTCATAGATCAAGCTGGG - Intronic
1000566958 5:162860245-162860267 TTGAATCTATAGGTCAATTTGGG - Intergenic
1000839440 5:166198406-166198428 TTGAATTTACAGATCAATTTGGG + Intergenic
1000859687 5:166441248-166441270 TTGAATCTGTAGATCAATTTGGG + Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1001457896 5:171880496-171880518 TTGAACCTACAGACCAATTTGGG + Intronic
1001462630 5:171931098-171931120 TTGAATCTATAGATCCAGTTGGG - Intronic
1001538518 5:172519030-172519052 TTGAATCTATAGATCGAATTGGG - Intergenic
1001736886 5:174012645-174012667 TTGAATCTATAGATCAGTTTGGG + Intergenic
1001870054 5:175145951-175145973 TTGAATCTATAGAACAAGTTGGG - Intergenic
1002002486 5:176205562-176205584 TGGAATCTACAGATTAATTTGGG + Intergenic
1002003563 5:176213907-176213929 TTGAAGCTATAGATCAATTTGGG - Intergenic
1002222894 5:177697009-177697031 TTGAAGCTATAGATCAATTTGGG + Intergenic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002615276 5:180449662-180449684 TTAAATCTATAGATCAATTTGGG - Intergenic
1002631709 5:180585845-180585867 TTGAATCTGTAGATCAATTTAGG - Intergenic
1002657709 5:180765148-180765170 TTGAATCTATAAATCAACTTGGG - Intergenic
1002767032 6:250301-250323 TTGAATCTGTAGATCAATTTGGG + Intergenic
1002844054 6:930386-930408 TTGAACCTGCAGATCAATTTGGG - Intergenic
1002892211 6:1344914-1344936 TTGAACCTATAGATCAAGTTTGG - Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1003483978 6:6559059-6559081 TTAAAACTACAGATCAATTTAGG + Intergenic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004074340 6:12331371-12331393 ATTATTCTACAGATAAAGCTTGG - Intergenic
1004353798 6:14913989-14914011 TTAAATCTACAGATCACTTTGGG - Intergenic
1004530399 6:16449393-16449415 TTAAATCTAAAGTTCAAGATTGG + Intronic
1004788646 6:18998534-18998556 TTGAATTTATAAATCAAGTTGGG + Intergenic
1004792836 6:19046958-19046980 TTGAATCTATATATCAATTTGGG + Intergenic
1004820121 6:19358818-19358840 GAGTATCTACAGGTCAAGCTTGG + Intergenic
1005007532 6:21303935-21303957 TTGAATCTATAGATCAACTTAGG - Intergenic
1005100287 6:22165347-22165369 TTGAATCTATAGATCACTTTAGG + Intergenic
1005129148 6:22484498-22484520 CTCAATCTATAGATCAAGTTGGG - Intergenic
1005216836 6:23538856-23538878 TTGAATCTATAGATTAAGTTGGG + Intergenic
1005228199 6:23667590-23667612 TTGAATTTATAGATCAAATTGGG + Intergenic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1005607296 6:27487422-27487444 TTGAATCTATTGATCAATTTAGG - Intergenic
1005658100 6:27964728-27964750 TTGGATCTATAGATCAATTTGGG + Intergenic
1005708675 6:28482295-28482317 TTGTATCTATAGATCAAATTGGG - Intergenic
1006035937 6:31212204-31212226 TTGATTCTATAGATCAGGTTGGG - Intergenic
1006431123 6:33996557-33996579 TTGAATCTACAGATCATTTTGGG - Intergenic
1006482750 6:34311503-34311525 TTGAATCTGTAAATCAAGTTGGG - Intronic
1007159934 6:39781668-39781690 CTGAGTCTATAGATCAATCTGGG + Intergenic
1007920389 6:45604033-45604055 TTGAATCTACAGATAAATTTGGG - Intronic
1008013860 6:46495875-46495897 TTTAATCTACAGATCAAGGTGGG + Intergenic
1008258714 6:49337887-49337909 TTGAATCTACAGATCAGTTTGGG - Intergenic
1008551285 6:52633935-52633957 TTGAATCTACAGGCCAATTTTGG - Intergenic
1008740931 6:54607161-54607183 TTGAATCTATAAATCAAGTTGGG + Intergenic
1008863115 6:56175704-56175726 TTGAATCTGTAGATCAAGTTAGG - Intronic
1008873070 6:56295509-56295531 TTGAATCCATAGATGAAGTTAGG + Intronic
1008948071 6:57121441-57121463 TTGAATATATAGATCAAGTTAGG + Intronic
1009873627 6:69478660-69478682 TTGAATCTATAGGTCAAATTGGG - Intergenic
1009879627 6:69549951-69549973 TTCAATCTACAGATCAATTTGGG + Intergenic
1010035052 6:71315626-71315648 TTGAATCTAAAGATCAATTTGGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010219310 6:73433900-73433922 TTGAATCTATAGATAAATTTGGG - Intronic
1010426853 6:75737341-75737363 TTGCATATACAGAGCCAGCTGGG - Intergenic
1011017854 6:82778612-82778634 TTGAATCTACAGAGCAATTTGGG - Intergenic
1011137919 6:84119247-84119269 TTGAATCTACAGATTACATTGGG + Intergenic
1011229997 6:85150078-85150100 TTGAATCTATAGATCACTTTGGG + Intergenic
1011238639 6:85246479-85246501 TTGAATCTATAGACCAATTTGGG - Intergenic
1011505109 6:88033238-88033260 TTGAATCTACAGATCAAGTTGGG + Intergenic
1011577628 6:88820880-88820902 TTGAATCTGTAGATCAAATTGGG - Intronic
1011911200 6:92441652-92441674 TTCATTCTACAGAGCAGGCTGGG + Intergenic
1011963573 6:93123035-93123057 TTGTATCTATACATCAAGGTGGG + Intergenic
1012293417 6:97488563-97488585 TTGCATCTACAGATCACGTTGGG + Intergenic
1012332200 6:98006486-98006508 ATGAATCTGTAGATCAAGTTAGG + Intergenic
1012397536 6:98817034-98817056 TTGAATCTACCTATCAATTTGGG - Intergenic
1012489675 6:99767902-99767924 TTAAATCTATAGATCAATTTGGG + Intergenic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1012619827 6:101329389-101329411 TTGAATCTGTAGCTCAATCTGGG + Intergenic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1013092779 6:106915655-106915677 TTGAATCTATAGATCCATTTGGG - Intergenic
1013148153 6:107415510-107415532 TTGAATCTACTGATTCTGCTTGG - Intronic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013320548 6:108983808-108983830 TTGAATCTACAGGTCACTCTGGG + Intergenic
1013440679 6:110163657-110163679 TTGAATCTACAGATCAAGTTGGG - Intronic
1013683802 6:112555039-112555061 TTGAATCTATAGATCAAGGTGGG + Intergenic
1013720620 6:113023386-113023408 TTGAATCTATAGCTCAAACTAGG - Intergenic
1013943996 6:115700802-115700824 TTGAATCTGCAGATCACTTTGGG + Intergenic
1014118951 6:117701142-117701164 TTGAATCTATAGCTCAATTTGGG + Intronic
1014178789 6:118360760-118360782 TTAAATCCATAGATCAAGTTGGG - Intergenic
1014394650 6:120910950-120910972 TTGAACCTACAGACCAAGCTGGG + Intergenic
1014521013 6:122441954-122441976 TTGAATCTATAGATCAGGTTGGG - Intergenic
1014558942 6:122867271-122867293 TTAAATCTATAGATCAATTTGGG + Intergenic
1014634905 6:123833493-123833515 TTGAAGCTATAGATCAAGTTGGG + Intronic
1014698432 6:124653083-124653105 ATGAATCTATCGATCAAGCTGGG - Intronic
1014784645 6:125604461-125604483 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1014994732 6:128127358-128127380 TTGAATCTTAAGATCAAGTTAGG + Intronic
1015101249 6:129483566-129483588 TTGAATCTACATATCATTTTGGG - Intronic
1015277222 6:131396114-131396136 TTAAACCTATAGATCAAGTTGGG - Intergenic
1015647788 6:135413919-135413941 TTGAATCTACAGATCATTTGGGG - Intronic
1015668149 6:135654980-135655002 TTGAATCTGTAGATCAATGTGGG - Intergenic
1015800393 6:137055369-137055391 TTGAATCTGTAGATCAATTTGGG - Intergenic
1015887762 6:137936560-137936582 TTGAATCTATAGATCACTTTGGG + Intergenic
1016076310 6:139800529-139800551 TTTAGTCTACAGATAAAACTTGG + Intergenic
1016169932 6:140999925-140999947 TTGAATCTATAGGTCAAGTTGGG + Intergenic
1016177085 6:141093678-141093700 TTGAATTTATAGATTAAGTTGGG + Intergenic
1016247404 6:141999628-141999650 TTGAATCTACAGATTTCTCTGGG - Intergenic
1016432547 6:144002833-144002855 TTGACTCTACAGAGCAACTTTGG - Intronic
1016859481 6:148702562-148702584 TTTAATCTATAGATCCAGTTGGG + Intergenic
1017365296 6:153629353-153629375 TTGAATCTACTCAGCTAGCTTGG + Intergenic
1017397670 6:154021524-154021546 TTGGATCTATACATCAAGTTGGG + Intronic
1017597176 6:156042160-156042182 TTGATTGTACAGATCAATTTCGG - Intergenic
1017610494 6:156181050-156181072 TTGAATCTATAGATCACTTTGGG + Intergenic
1017624375 6:156333286-156333308 TTGAATCTATATATCAAGTTGGG + Intergenic
1017932116 6:158965349-158965371 TTGAATCTGGAGATCACTCTGGG + Intergenic
1018097571 6:160404516-160404538 TTGAATATATACATCAAGTTGGG - Intronic
1018347353 6:162914641-162914663 TTGAATCTATAGATCAACCTGGG + Intronic
1018597822 6:165501728-165501750 TTTACTCTACAGATCAATTTGGG - Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1018863282 6:167728134-167728156 TTAAATCTACAGATCAAGTTGGG - Intergenic
1019836829 7:3394587-3394609 TTGAATGTATAGATCAATTTGGG + Intronic
1020075732 7:5257508-5257530 TTGAATCTATAGATCAAGTAGGG - Intergenic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1020760733 7:12265602-12265624 TTGAATCTATAGACCAATTTAGG + Intergenic
1020851710 7:13361739-13361761 TTGAATCTATAGATCACCTTGGG + Intergenic
1021211457 7:17858561-17858583 TTGAATCTATAGATGAATTTAGG - Intronic
1021331526 7:19344174-19344196 TTGAATGTGTAGATTAAGCTGGG + Intergenic
1021381646 7:19974656-19974678 TTGTATCTATATATCAAGTTAGG + Intergenic
1021437708 7:20639918-20639940 TTGAATCTATAGATAAATTTGGG + Intronic
1022016630 7:26355389-26355411 TTAAACCTACAGATCAATTTGGG + Intronic
1022043692 7:26605139-26605161 TTTAATCTAAAGATTCAGCTGGG - Intergenic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1022296367 7:29058088-29058110 TTGAATCTATGGATCAAGTTGGG + Intronic
1022307811 7:29165121-29165143 TTTAATCTAAAGATCAATGTGGG + Intronic
1022381412 7:29863637-29863659 TTGAATTTACAGATCAACCTGGG + Intronic
1022604790 7:31800804-31800826 TTGAACCTATAGATCAACATGGG + Intronic
1022688955 7:32626686-32626708 CTGAATCTGTAGATCAAGTTGGG - Intergenic
1022900540 7:34805108-34805130 TTGAATTTATAGATCACGTTGGG - Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023149365 7:37185891-37185913 TTGAATCTGTAGATCAATTTAGG - Intronic
1023217582 7:37880706-37880728 TTTAATCTACAGACCAAGTTGGG + Intronic
1023553570 7:41395553-41395575 TTGAACCTATAGATCAATTTTGG + Intergenic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023649472 7:42353851-42353873 TTGAATCTACAGATCAATTTGGG - Intergenic
1023838756 7:44083722-44083744 TTGAATCTATAGATCAAGCTGGG + Intergenic
1024023708 7:45393165-45393187 TTAAATCTATAGATCAATTTGGG + Intergenic
1024032441 7:45474383-45474405 TTGAATCTATAGCTTAAGTTGGG - Intergenic
1024190783 7:47006786-47006808 TTGAATCTATAGGTCGAGTTGGG - Intergenic
1024221328 7:47289817-47289839 TTGAATCTATAGATGAAATTAGG - Intronic
1024334003 7:48185502-48185524 TTGAGCCTACAGATCAATCTGGG + Intronic
1024467380 7:49726473-49726495 TTGCATCTATAGATCAATTTAGG + Intergenic
1024583539 7:50821336-50821358 ATGAATCTGCAGATAAAGATAGG - Intergenic
1024690110 7:51791551-51791573 TTGAATCTATAGATCAAATTGGG - Intergenic
1024720511 7:52131914-52131936 TTGAATCTGCAGATAAAGTTGGG + Intergenic
1024749106 7:52443313-52443335 TTGAATCCATAGATCCAGTTAGG + Intergenic
1024854886 7:53766948-53766970 TTGAACCTATAGATCATGTTGGG + Intergenic
1025203346 7:56976049-56976071 TTGAATCTATAGATCAAGTAGGG + Intergenic
1025668598 7:63600878-63600900 TTGAATCTATAGATCAAGTAGGG - Intergenic
1026021637 7:66712155-66712177 TTAAATCTACAGATCACTTTGGG + Intronic
1026591976 7:71704438-71704460 TTGAATCTCTAGATCAATTTAGG - Intronic
1026886043 7:73946700-73946722 TTAAATCTACAGATCAGTTTGGG + Intergenic
1027301557 7:76842517-76842539 TTGAATCTATGGATCAAGCTGGG - Intergenic
1027334740 7:77137671-77137693 TTGAATCTACAGATCAATTTGGG - Intronic
1027387976 7:77677297-77677319 TTGAATCTATAGATGAAGTTGGG + Intergenic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1027617172 7:80437623-80437645 TTTAATCTATAAAGCAAGCTAGG - Intronic
1028004314 7:85542877-85542899 TTGAATCTATATATCAAGTTGGG + Intergenic
1028043311 7:86086253-86086275 TTGAATCTATAGACCACTCTGGG + Intergenic
1028046991 7:86132800-86132822 TTGAATCTATAAATCAAGCTGGG + Intergenic
1028294584 7:89112686-89112708 TTAAATCTATAGATCAAGTTGGG + Intronic
1028344666 7:89764511-89764533 TTGAATCTGTAGATCAATTTGGG - Intergenic
1028358362 7:89937094-89937116 TTGAATCTATAGATCAATGTGGG + Intergenic
1028372516 7:90109918-90109940 TTGAATATATAGATCAAGTTGGG - Intergenic
1028815359 7:95137632-95137654 TTGACTCTACAGATCAATATGGG - Intronic
1028911693 7:96214976-96214998 TTGAATCTATAGATCATTTTAGG - Intronic
1029038254 7:97545881-97545903 TTAAATCTACAGATCAATTTGGG - Intergenic
1029781061 7:102733431-102733453 TTGAATCTACAGATCAATTTGGG + Intergenic
1029833776 7:103288324-103288346 TTGAATATATAGATCAAGTTGGG + Intergenic
1029916709 7:104217508-104217530 TTGAATCTACACATCAATTTGGG - Intergenic
1030180159 7:106698858-106698880 TTGAATCTATAGATCAAGGTAGG + Intergenic
1030224608 7:107135794-107135816 TTGAATCTACAGATCAACTTGGG - Intronic
1030257173 7:107523076-107523098 TTGAATTCATAGATCAAGTTGGG + Intronic
1030423523 7:109340477-109340499 TTGAATCTGTACATCAAGTTGGG + Intergenic
1030542419 7:110847497-110847519 TTGAACCTACAGCTCAAGTTAGG - Intronic
1030790424 7:113720403-113720425 TTGAATCTACAGATCAAGTTTGG - Intergenic
1030794164 7:113767038-113767060 TTGAATCTATAGATCACTTTGGG + Intergenic
1030826486 7:114165691-114165713 TTGAATATACATATCAACTTAGG - Intronic
1031112944 7:117633081-117633103 TTGAATCTATAGATGGAGTTGGG + Intronic
1031160678 7:118164096-118164118 CTGAATCTACAGATTAATTTAGG + Intergenic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1031354386 7:120772991-120773013 TTGAACCTAAAGATCAATTTGGG + Intergenic
1031430346 7:121660645-121660667 TTCTATCTATAGATCGAGCTGGG + Intergenic
1031773403 7:125874884-125874906 TTGAATCTACAAATCAATTTTGG + Intergenic
1031879836 7:127185042-127185064 TTGAATTTATAGACCAAGTTGGG - Intronic
1031924405 7:127625055-127625077 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1032288229 7:130560410-130560432 TTGAATCTATAAATCAATTTGGG - Intronic
1032769906 7:135041194-135041216 TTAAATCTACAGATCAACTTGGG - Intronic
1033004047 7:137540958-137540980 TTGAGTCTATAGATCAACTTGGG - Intronic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1033100580 7:138467293-138467315 TTGAATCTAGATATCAATTTGGG + Intronic
1033382642 7:140838536-140838558 TTGAATCTGTAGATCAACTTGGG - Intronic
1034024969 7:147691492-147691514 TTGAATCTGTAGATCAAGTTAGG - Intronic
1034031462 7:147770777-147770799 TTTACTCTACAGATCAATTTTGG - Intronic
1034320421 7:150174922-150174944 TTGAATCTACTGATCAATTTGGG - Intergenic
1034354370 7:150440973-150440995 TTGAATGTATAGATCAATTTTGG + Intergenic
1034524242 7:151646252-151646274 TTTGATCTACAGATCAATTTGGG + Intronic
1034788996 7:153950860-153950882 TCGAACCTGAAGATCAAGCTGGG + Intronic
1034892035 7:154849244-154849266 TTGAATCTACAAATCACTTTTGG + Intronic
1035409407 7:158626977-158626999 CTAAATTTACAGATCAAGCTGGG - Intergenic
1035440684 7:158895698-158895720 TGGAATCTATAGGTCAAGTTGGG + Intronic
1035742805 8:1941531-1941553 TTGAATCTGCAGATCCAATTGGG - Intronic
1036162696 8:6404602-6404624 TTGACTCTACAGATGAATTTGGG - Intergenic
1036423649 8:8622228-8622250 TTAAATCTATATATCAAGTTGGG - Intergenic
1036580383 8:10068852-10068874 CTGAATCTCCAGATCAAGTTGGG + Intronic
1036597953 8:10231079-10231101 TTAAAACTACAGAACAGGCTGGG - Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1037125969 8:15350074-15350096 TTGAATCTACAGATTATTTTGGG - Intergenic
1037140364 8:15511940-15511962 TTGAATCTATAGATAAATTTAGG - Intronic
1037537643 8:19840350-19840372 TTGAATCTACAGATACACGTGGG - Intronic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038025737 8:23588231-23588253 TTGAATTTATAGATCAATCTGGG + Intergenic
1038232148 8:25711351-25711373 TTGAATCCACAGTTCAATTTGGG + Intergenic
1038273009 8:26091785-26091807 TTGAATCTACAGATCAAGTTGGG - Intergenic
1038730545 8:30122828-30122850 TTGAAGCTATAGATCAATTTGGG + Intronic
1038752513 8:30309154-30309176 TTGAATCTATGGATCAAGTTGGG + Intergenic
1038789119 8:30651660-30651682 TTGAATCTATAAATCAATTTGGG - Intronic
1039296836 8:36165501-36165523 TTAAATCTTTAGATCAATCTGGG + Intergenic
1039358776 8:36851144-36851166 TTGAATCTATAGATAAATTTTGG + Intronic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1039625411 8:39046037-39046059 TTGAATCTGCAGATCACTTTGGG + Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039805820 8:40997139-40997161 TTGAATCTGTAGATCAATTTAGG + Intergenic
1039924873 8:41920624-41920646 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1040064269 8:43132200-43132222 TTGAACTTATAGATCAATCTGGG + Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1040525516 8:48220540-48220562 TTGAATCTACAGGTCAATTTCGG - Intergenic
1040652966 8:49470336-49470358 TTGGATCTATAGATCAAAGTGGG - Intergenic
1040830493 8:51671372-51671394 TAGAAGCTACAGTTCAACCTGGG + Intronic
1040994239 8:53385806-53385828 TTGAATCTATAAATCAATTTAGG + Intergenic
1041012075 8:53554362-53554384 TTGAATCTATAGATCAGTTTAGG - Intergenic
1041033760 8:53765703-53765725 TTGAATCTGTAAATCAAGTTGGG - Intronic
1041093175 8:54323339-54323361 TTGAATCTATAGATTAAGTTGGG - Intergenic
1041111081 8:54483021-54483043 TTGAATCTCTAGACCAGGCTAGG - Intergenic
1041305698 8:56456232-56456254 TTGAATCTATAGATAACTCTGGG - Intergenic
1041577309 8:59413753-59413775 ATGAACCTGTAGATCAAGCTGGG - Intergenic
1041791978 8:61706581-61706603 TTGAATCTATAGAACAATTTGGG - Intronic
1041892306 8:62883127-62883149 TTGAATCTATAGATTAAGTTGGG + Intronic
1042074304 8:64973169-64973191 TTGAATCTGCAGATCATTTTGGG + Intergenic
1042157513 8:65861843-65861865 TTGAGGCTATAGATCAAGTTGGG + Intergenic
1042186532 8:66141413-66141435 GTGAACCTTCAGATCATGCTGGG - Intronic
1042366657 8:67944941-67944963 TTGAATCTATAGATCAAATTGGG - Intergenic
1042371594 8:67997682-67997704 GTGAATCTATAGATCAATTTTGG + Intronic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042538486 8:69883441-69883463 TTGAATCTAAAGATCAATTTGGG - Intergenic
1042617555 8:70666940-70666962 TTGAGTCTGAAGATCAAGTTTGG + Intronic
1042673808 8:71294662-71294684 TTGAATTTATAGATCAAATTGGG - Intronic
1042779390 8:72474125-72474147 TTGAATCTATAGAACAAATTGGG - Intergenic
1042974351 8:74449396-74449418 TTGAATTTATAGATCAATTTGGG + Intronic
1043234759 8:77849348-77849370 TTGAATTTATAGATCAAGTTAGG + Intergenic
1043327172 8:79066787-79066809 TTGAATCTATTCATCAAGTTAGG - Intergenic
1043541941 8:81273864-81273886 TTGAATCTACAGATCACTTTGGG + Intergenic
1043562339 8:81508387-81508409 TTGAATCTATAAATCAAGATGGG - Intergenic
1043793834 8:84510073-84510095 TTGAATCTATGGATAAAGTTGGG + Intronic
1043828898 8:84964092-84964114 TTGAATTTATAGATCAAATTAGG - Intergenic
1044175520 8:89116158-89116180 TGGAATCTATAGATCACACTGGG - Intergenic
1044249184 8:89986486-89986508 TTGAATCTATAGAACAATTTTGG - Intronic
1044312912 8:90715333-90715355 TTGAATCTACAGGTAAAGTTAGG + Intronic
1044322298 8:90816877-90816899 TTGAATCAATAGATTAAGTTGGG + Intronic
1044411686 8:91891263-91891285 TTGAATCTGTAGATCAATTTAGG - Intergenic
1044894698 8:96879059-96879081 TTGAATCAACAGATTAATATAGG + Intronic
1044998923 8:97863344-97863366 TTGAATCTGTAGATCAATTTGGG + Intergenic
1045119312 8:99017878-99017900 TTGAATCTATCGATCAATTTTGG + Intronic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1045619980 8:103965222-103965244 TTGAATCTGTAGGTCAAGTTGGG + Intronic
1045698916 8:104843271-104843293 TTGAATCTACAGATTACTTTTGG + Intronic
1045811810 8:106230243-106230265 TTGACTCTATGGATCAAACTGGG + Intergenic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046040557 8:108898453-108898475 TTGAATCTATAGATCACTTTAGG - Intergenic
1046113611 8:109757647-109757669 TTGAATCTATAGATCAAATTGGG + Intergenic
1046388669 8:113538783-113538805 TTGAATCTACAGATCAAGTTAGG + Intergenic
1046434822 8:114173973-114173995 TTGAATCTATAGATGAATTTGGG - Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1046508566 8:115169442-115169464 TTAAATCTATAGATCAAATTGGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046698097 8:117365299-117365321 TTGATTCTATAGATCATTCTGGG + Intergenic
1047036571 8:120945824-120945846 TTGAATCTGTAGATCATGTTGGG + Intergenic
1047128329 8:121988311-121988333 TTGAATCTATAGATCAAGCTGGG - Intergenic
1047763717 8:127972872-127972894 TTTAATATACAGCTCAAACTTGG - Intergenic
1047867093 8:129037189-129037211 TTGAATCTACACATCAATTTGGG - Intergenic
1047890694 8:129304804-129304826 TTGAATCTGTAGATCAACTTGGG + Intergenic
1048130461 8:131690769-131690791 TTGAATCTGAAGATCAGTCTGGG + Intergenic
1048186549 8:132247270-132247292 ATGAAGCTAGAGATTAAGCTGGG + Intronic
1048226592 8:132593497-132593519 TTGAATCTGTAGGTCAATCTGGG - Intronic
1048415258 8:134221072-134221094 CTGAATCTACAGATCACTTTGGG - Intergenic
1048562091 8:135550790-135550812 TTGAATCTATAGATCAGTTTGGG + Intronic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1049049036 8:140177662-140177684 TTGAATATAAAGATCAATTTGGG + Intronic
1049295616 8:141833846-141833868 TTGAATCTATAGATGAACTTCGG + Intergenic
1050002146 9:1088700-1088722 TTGAATGTACAGATTAATTTGGG + Intergenic
1050426856 9:5520007-5520029 TTGAATCCATAGATCAATTTGGG - Intronic
1050452309 9:5796134-5796156 TTGAGTCTGTAGATCAAGGTGGG - Intronic
1050634716 9:7599517-7599539 TTGAATCTATAGATCACTTTGGG - Intergenic
1050695233 9:8271992-8272014 TTGAGTCTACAGATCAAGTTGGG + Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1050792724 9:9494736-9494758 TTGAATCTATAGATCACTTTGGG - Intronic
1050905723 9:11002734-11002756 TTGAAATGACAGATCATGCTAGG - Intergenic
1050914961 9:11120403-11120425 TTGAATATATTGATCAAGTTGGG + Intergenic
1051116421 9:13699079-13699101 CTGAATCTATAGATCAAGTGGGG + Intergenic
1051317239 9:15853142-15853164 TTGAATTTATAGATCAATTTGGG + Intronic
1051427575 9:16949028-16949050 TTGAATCTGTAGATCAATTTAGG + Intergenic
1051427588 9:16949396-16949418 TTGAATCTGTAGATCAATTTCGG - Intergenic
1051607749 9:18932603-18932625 TTGAATCTACAGATCAATTTGGG + Intronic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1052009884 9:23395135-23395157 TTGAATCTATAGATCACTGTGGG - Intergenic
1052133056 9:24873977-24873999 TTGAATCTATAGATCACATTGGG + Intergenic
1052327922 9:27236691-27236713 TTGAATCTATGGATCACACTGGG - Intergenic
1052615611 9:30836482-30836504 TTGACTCTATAGATCAAGTTGGG + Intergenic
1052665532 9:31490427-31490449 ATAAATCTATAGATCAAGTTTGG + Intergenic
1052751902 9:32500291-32500313 TTGAATATACAGATCAATGTAGG + Intronic
1052754613 9:32527689-32527711 TTGAACCTACAGATAAACTTGGG + Intergenic
1053033697 9:34806283-34806305 TTGAATCTATAGATCAATGTGGG + Intergenic
1055015352 9:71611414-71611436 GTAAATCTATAGATCAAGTTGGG - Intergenic
1055222186 9:73949589-73949611 TTTAATCTACAGATCAAGATGGG - Intergenic
1055378671 9:75682028-75682050 TTGAATTTATAGATCAAGTAGGG - Intergenic
1055464236 9:76548358-76548380 TTGAACCTATAGATCAATTTGGG + Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1055906432 9:81299868-81299890 TTGAATCTATATATCAAGTTTGG - Intergenic
1056000512 9:82211372-82211394 TTGAATCTACAGATGAATGTAGG - Intergenic
1056155249 9:83828402-83828424 TTGAATCTGTAGATCAATTTGGG - Intronic
1056171739 9:83992048-83992070 TTGAATCTATAGATGAATTTGGG + Intronic
1056308686 9:85318434-85318456 TTTAATCTATAGATCAATTTGGG - Intergenic
1056355237 9:85794711-85794733 TTGAATCTGTAGATCAATTTGGG + Intergenic
1056588256 9:87943138-87943160 TTGAATCTGTAGATCAATTTGGG + Intergenic
1056871184 9:90281508-90281530 TTGAATCTGCAGATCACTTTGGG - Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057098580 9:92335948-92335970 TTGAATGTACTGATCAAAGTTGG + Intronic
1057364456 9:94405859-94405881 TTGAATCTGCAGATCACTTTTGG + Intronic
1057473400 9:95378610-95378632 TTGAATTTATAGATCAATTTGGG + Intergenic
1057658875 9:96982208-96982230 TTGAATCTGCAGATCACTTTTGG - Intronic
1057808373 9:98237830-98237852 TTGAATCTGTAGATCAATTTGGG + Intronic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1057926562 9:99156910-99156932 TTGAATCTATAGAACAATTTGGG - Intergenic
1058205034 9:102094231-102094253 TTGAATCTATAGGTCAAGTTGGG - Intergenic
1058275907 9:103040446-103040468 TTGAAACTATATATCTAGCTCGG - Intergenic
1058320167 9:103620222-103620244 TTCAGTTTACATATCAAGCTTGG - Intergenic
1058326551 9:103705554-103705576 TTTAATCTAAAGATCAATTTGGG - Intergenic
1058454018 9:105122574-105122596 ATAAATCTACAGATCAATTTGGG - Intergenic
1058698371 9:107579495-107579517 TTGAATTTGCAGATCAGTCTAGG + Intergenic
1059066078 9:111085600-111085622 TTGAATCTGCAGATCACTTTGGG + Intergenic
1059090654 9:111354506-111354528 TTGAATCTGTAGATCAACTTGGG + Intergenic
1059347784 9:113642648-113642670 TTGAATCTGTAGATCAATTTGGG + Intergenic
1059394084 9:114020381-114020403 TTGAATCTGTAGATCAATTTGGG + Intronic
1059474789 9:114536977-114536999 TTGAACCTGCAGATCAATTTTGG - Intergenic
1059667170 9:116458833-116458855 TTGAATCTACAGATAAATTTGGG - Intronic
1059881738 9:118697899-118697921 TTGAATCTATAGATCAAATTTGG - Intergenic
1060162514 9:121378617-121378639 TTGGATCTATACATCAAGTTGGG - Intergenic
1060305592 9:122408587-122408609 TTGAATCTATAGATCAAATAGGG + Intergenic
1060320679 9:122556818-122556840 TTGAATCTATTAATCAAGTTGGG + Intergenic
1060323269 9:122586264-122586286 TTGAATCTATAGATCAATCTGGG - Intergenic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1060447142 9:123700309-123700331 TTGACTCTATAGATCAATTTGGG + Intronic
1060509616 9:124222399-124222421 TTGAAGTGACAGATGAAGCTAGG - Intergenic
1061447118 9:130645746-130645768 ATGAATCTATAGATCAATTTGGG + Intergenic
1061815693 9:133193602-133193624 TTGCATCTATAGATCAATTTGGG - Intergenic
1062127920 9:134874771-134874793 TTGCATCTGCAGATCAATTTGGG + Intergenic
1185808830 X:3086053-3086075 TTGCATCTACAGAGCAAGTATGG - Intronic
1186291284 X:8102656-8102678 TTGAATCTCTAGATCAATTTTGG - Intergenic
1186668682 X:11746390-11746412 ATGAATCTATAGATCAATTTAGG + Intergenic
1187335803 X:18380463-18380485 TTGAATCTATAGATCAAATTGGG + Intergenic
1187371561 X:18712227-18712249 TTGAATCTGTAGATCAATTTGGG + Intronic
1187431789 X:19231804-19231826 TTGAATCTACAAATCACTTTGGG - Intergenic
1187643805 X:21324146-21324168 TTGAATCTATAGATCAGTTTGGG + Intergenic
1187808758 X:23152054-23152076 TTGAATTTATAGATCAATTTGGG - Intergenic
1188163892 X:26837569-26837591 TTGAATCTATAAATCATGTTGGG + Intergenic
1188195867 X:27232552-27232574 ATGGAACTACAGATCAATCTGGG - Intergenic
1188599897 X:31949221-31949243 TTAAATCTATAGAACAAGTTGGG + Intronic
1189361443 X:40356225-40356247 TTGAATCTGAAGATCAATTTGGG - Intergenic
1189424765 X:40888871-40888893 TTAAATCTATAGATCAAGTTGGG + Intergenic
1189527740 X:41842740-41842762 CTGAATCTATAGATCAATTTGGG + Intronic
1189548176 X:42065563-42065585 TTGAATCTATAGATTAAGTTAGG + Intergenic
1189648531 X:43161883-43161905 ATAAACCTACAGATCAAGTTGGG - Intergenic
1189718450 X:43889279-43889301 TTGAATCTATAGATCACTTTGGG + Intergenic
1189769498 X:44409790-44409812 TTGAGTCTATAGATCAATTTGGG - Intergenic
1190084061 X:47380093-47380115 TTGAATCTCCTGATCAAGGTGGG + Intronic
1190392279 X:49943970-49943992 TTGAATCTATAAATTAACCTTGG + Intronic
1190402456 X:50051582-50051604 TTGAATCTATAGATCAAGCTGGG + Intronic
1190418947 X:50208393-50208415 TTGATTCTGTAGATCAATCTGGG + Intronic
1190419374 X:50213154-50213176 TTGATTCTGTAGATCAATCTGGG + Intronic
1190451990 X:50591460-50591482 TTGAATCTGTAGATCAATTTGGG + Intergenic
1190492437 X:50995531-50995553 TTGAATATACAGATCAATTTTGG - Intergenic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1190625458 X:52333737-52333759 TTGAATCTATACATTAAGTTTGG + Intergenic
1190689924 X:52905132-52905154 TTCATTCTACAGATCAAGTTGGG + Intronic
1190696059 X:52950660-52950682 TTCATTCTACAGATCAAGTTGGG - Intronic
1190716384 X:53107496-53107518 TTGAATCTATATATCAACTTGGG + Intergenic
1190962447 X:55266293-55266315 TTGAATCTATAGCTCAATTTGGG - Intronic
1191156543 X:57280170-57280192 TTGAATCTATAGACCAATTTGGG - Intergenic
1191684520 X:63875976-63875998 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1192187871 X:68965530-68965552 TTTAATCTACAGATCAAGTTGGG + Intergenic
1192193100 X:69007208-69007230 TTAAATCTGCAGATCAAATTTGG + Intergenic
1192272313 X:69593387-69593409 TTAAATCCATAGATCAATCTGGG - Intergenic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192382607 X:70634294-70634316 TTGAATCTATAGATCAGCTTGGG - Intronic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192540465 X:71965675-71965697 TTGAATCCATAGATCAAGTTGGG + Intergenic
1192678731 X:73229122-73229144 TTGAATCAGTAGATCAATCTGGG + Intergenic
1193393007 X:80951215-80951237 TTGAATCTAAAGATCAATTTGGG + Intergenic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1193503681 X:82311620-82311642 TTGAATCTTTAGATCAATTTGGG + Intergenic
1193552062 X:82906644-82906666 TTGAATCTAGAGATAAATTTAGG + Intergenic
1193888145 X:87008561-87008583 TTAAATCTATAGATCAATTTAGG - Intergenic
1193986495 X:88247666-88247688 TTGAATCTGTAGATCAATTTGGG + Intergenic
1194060724 X:89193789-89193811 TTGAATCTACAGATTTAGTTGGG + Intergenic
1194124639 X:90000619-90000641 TTGAATCTTGAAATCAAGTTAGG + Intergenic
1194234353 X:91363550-91363572 TTTAATCTACAGATCAATTTTGG + Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194519762 X:94903661-94903683 TTAAATCTGTAGATCAAGTTTGG + Intergenic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1194652130 X:96528290-96528312 TGGAATCTATAGATCAATTTAGG - Intergenic
1194760076 X:97785566-97785588 TTGAATCTATACATCAACTTGGG - Intergenic
1194769854 X:97888786-97888808 TTGAATCTACAGATTAATTTGGG + Intergenic
1194864094 X:99044215-99044237 TTGAATCAATATATCAAGTTGGG + Intergenic
1194929873 X:99874222-99874244 TTGAATCCATAGATCAATTTTGG - Intergenic
1194979531 X:100426112-100426134 TTTAGTCTACAGATAATGCTTGG + Intergenic
1195331365 X:103804588-103804610 TTGATTCTATAGATCAATTTGGG + Intergenic
1195499787 X:105582385-105582407 TTGAATCTATAGATCCATTTGGG + Intronic
1195587339 X:106579931-106579953 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1195609068 X:106843773-106843795 TTGAATCTGTAGATCAATTTCGG + Intronic
1195682366 X:107558083-107558105 TTGAAACTATAGATCAATTTGGG + Intronic
1195826638 X:109009091-109009113 TTAAATCTGTAGATCAAACTGGG - Intergenic
1196191192 X:112796636-112796658 GTGGATCTAAAGATCAAGCCAGG - Intronic
1196352517 X:114748339-114748361 TTGAATCTACAGATCATTTGGGG - Intronic
1196609356 X:117693982-117694004 TTAACACTACAGATCAAGTTGGG + Intergenic
1196849951 X:119927867-119927889 TTGAATATAAAGATCAATTTGGG + Intronic
1196852664 X:119952759-119952781 TTCAATCTACAGGTCAAGTTGGG + Intergenic
1197038049 X:121902088-121902110 TTGAACCTATAAATCAAGTTAGG + Intergenic
1197450678 X:126612099-126612121 TTAAATCTATAGATCAAATTGGG - Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1197588595 X:128381356-128381378 TTGAATCTATAGATCACCTTGGG - Intergenic
1197599042 X:128505531-128505553 TTAAATCTACAGATCAATTTGGG - Intergenic
1197651544 X:129070791-129070813 TTGAATCTATAGATCATTTTGGG + Intergenic
1197683299 X:129409731-129409753 TTGAATCTATACATCAATTTGGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1198007610 X:132513932-132513954 TTGAATCTATAGATCTATTTGGG - Intergenic
1198181227 X:134211409-134211431 TTGAATCTGTGGATCAAGTTGGG - Intergenic
1198195893 X:134361471-134361493 TTGAATCTGTAGATCAATTTGGG - Intergenic
1198268055 X:135029180-135029202 TTGAATCTATACATCAATTTTGG + Intergenic
1198367433 X:135955687-135955709 TTGAATCTATAGATCACGCTGGG - Intergenic
1198501152 X:137248347-137248369 CTGAATCTACAGATCATTTTGGG - Intergenic
1198608109 X:138366920-138366942 TTGAATCTGTAGATCAACCCGGG + Intergenic
1198784881 X:140276106-140276128 TTGAATTTATAGATCAGTCTGGG + Intergenic
1198842549 X:140874146-140874168 TTGAATCTATATATCAAGTTAGG - Intergenic
1198945935 X:142013868-142013890 TTGAAGCTACAGATTAATTTGGG + Intergenic
1199014313 X:142794807-142794829 TTGAATCCATAGATCAATTTGGG + Intergenic
1199128488 X:144155885-144155907 TTGAATTTATAGATCAATTTGGG - Intergenic
1199164076 X:144649109-144649131 TTTAATCTAAATATCAAGGTAGG - Intergenic
1199444443 X:147905717-147905739 TTGAATCTATAGATCAAGTAGGG - Intergenic
1199463940 X:148114955-148114977 GTGAATGTAGAGATCAACCTTGG + Intergenic
1199584498 X:149399539-149399561 TTGAATCTACAGATCAATTTGGG + Intergenic
1199613786 X:149639516-149639538 TTAAATATATAGATCAAGTTAGG - Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1199820873 X:151444176-151444198 TTGAATCCATAGATCAATTTGGG + Intergenic
1199883087 X:151991730-151991752 TTGAATCTATAAATCAATTTTGG + Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200209476 X:154340800-154340822 TTGAAACTACACATCAAGCCGGG + Intergenic
1200221400 X:154391328-154391350 TTGAAACTACACATCAAGCCGGG - Intronic
1200297589 X:154937846-154937868 TTGATTCTGCAGATCAATTTGGG - Intronic
1200304915 X:155014849-155014871 TTGAATCTGTAGATCAATTTGGG - Intronic
1200477533 Y:3658230-3658252 TTGAATCTTGAAATCAAGTTAGG + Intergenic
1201316623 Y:12653589-12653611 TTGAATCTGTAGATCAATTTGGG + Intergenic
1201856874 Y:18554347-18554369 TCAAATATATAGATCAAGCTGGG + Intronic
1201876447 Y:18766033-18766055 TCAAATATATAGATCAAGCTGGG - Intronic
1201966882 Y:19747234-19747256 TTGAATCTACAGACAAATTTAGG + Intergenic