ID: 1056927524

View in Genome Browser
Species Human (GRCh38)
Location 9:90847547-90847569
Sequence CTGCAGGTGTGGAGGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 0, 2: 16, 3: 90, 4: 698}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056927524_1056927530 -10 Left 1056927524 9:90847547-90847569 CCGTGCTCCCTCCACACCTGCAG 0: 1
1: 0
2: 16
3: 90
4: 698
Right 1056927530 9:90847560-90847582 ACACCTGCAGGGCTCACCTGTGG No data
1056927524_1056927535 25 Left 1056927524 9:90847547-90847569 CCGTGCTCCCTCCACACCTGCAG 0: 1
1: 0
2: 16
3: 90
4: 698
Right 1056927535 9:90847595-90847617 TAGCACCCCATGCCCAGGCCTGG No data
1056927524_1056927534 20 Left 1056927524 9:90847547-90847569 CCGTGCTCCCTCCACACCTGCAG 0: 1
1: 0
2: 16
3: 90
4: 698
Right 1056927534 9:90847590-90847612 GTGCATAGCACCCCATGCCCAGG No data
1056927524_1056927532 -2 Left 1056927524 9:90847547-90847569 CCGTGCTCCCTCCACACCTGCAG 0: 1
1: 0
2: 16
3: 90
4: 698
Right 1056927532 9:90847568-90847590 AGGGCTCACCTGTGGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056927524 Original CRISPR CTGCAGGTGTGGAGGGAGCA CGG (reversed) Intronic
900010660 1:104074-104096 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
900026763 1:280640-280662 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
900036558 1:414543-414565 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
900058187 1:650297-650319 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
900187872 1:1340951-1340973 GTGCAGGTGTGTAGTGTGCAGGG - Intronic
900242086 1:1621958-1621980 CTGCAGGTGAGCAGTGAGGAGGG - Intronic
900391986 1:2437572-2437594 CTGAAGGGGTGGAGGCTGCAGGG - Intronic
900399063 1:2465550-2465572 CAGCAGGTGAGGAGGCACCATGG - Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900484159 1:2913640-2913662 CTCCAGGGGTGGTGGGAGGAAGG - Intergenic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900618599 1:3576787-3576809 CTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618624 1:3576887-3576909 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618632 1:3576916-3576938 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618647 1:3576987-3577009 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618655 1:3577016-3577038 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
901063050 1:6482243-6482265 GACCAGGTGTGGAGGCAGCAGGG - Intronic
901154011 1:7123516-7123538 GAGCAGGTGTGGAGAGGGCAGGG - Intronic
901199605 1:7459141-7459163 CTGCTGGGGAGGAAGGAGCAAGG + Intronic
902108848 1:14060970-14060992 CTGCTGGTGTGGGAGGAGAAGGG - Intergenic
902203750 1:14852489-14852511 CTGCAGGTGGGGAGGGGGCTGGG - Intronic
902228792 1:15014182-15014204 CTGCAGGTGTGGATGGCTCTGGG - Intronic
902608786 1:17584795-17584817 TGGCTGGAGTGGAGGGAGCAAGG + Intronic
902622698 1:17659622-17659644 CTGGTGGTGTGGAGGGTCCAGGG + Intronic
903177796 1:21590925-21590947 CTGCAGGTGAAGAGGGGGCGAGG + Intergenic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903187895 1:21639697-21639719 GTGCGGATGTGGAGTGAGCAAGG + Intronic
903565520 1:24262461-24262483 CTGGAGCCTTGGAGGGAGCATGG - Intergenic
903778238 1:25806584-25806606 CTGTAGGCGGGGAGGGAGTAGGG + Intronic
904289342 1:29474058-29474080 CTGCAGGTCTAGAGGGTCCAGGG + Intergenic
904607226 1:31704398-31704420 GGACAGGGGTGGAGGGAGCAGGG + Intergenic
904768711 1:32869601-32869623 ATGCAGGTGGGGAGGTGGCAGGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905170648 1:36107814-36107836 CGGCATGTGTGCAGGAAGCAGGG - Intronic
905337495 1:37255573-37255595 CTGCTGGCGTGGAGGGGGCGGGG + Intergenic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
905827315 1:41035639-41035661 CTTCAGGAGTGGTGGGATCAAGG - Intronic
907011653 1:50968922-50968944 CTGTAGGGGTGAAAGGAGCAGGG + Exonic
907411960 1:54289521-54289543 CTGCAGGTCAGGAGGATGCAAGG + Intronic
907611117 1:55872170-55872192 CTCCATGTGTGGAGGGAGGGAGG - Intergenic
907870429 1:58437987-58438009 CTGCACATATGGAGGGAACATGG - Intronic
909125123 1:71658042-71658064 CTGGAGCTGTGCAGGGATCATGG - Intronic
909235918 1:73152633-73152655 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
910053809 1:83007889-83007911 ATGCAGCAGTGGAGGCAGCACGG - Intergenic
910510807 1:88001910-88001932 CGGCAGGGGTGGAAGGGGCAGGG + Intergenic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
912510338 1:110185379-110185401 CTGCTGGTGTGGAGCCAGCCGGG - Intronic
912999473 1:114565212-114565234 CTGCAGGCGTGTAGGGGGGACGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
918323051 1:183382997-183383019 CTGCAGGTGTGGAGCCCTCATGG - Intronic
919695844 1:200574381-200574403 CTGAAGGTGTGAAGGGTGCAAGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920178606 1:204118787-204118809 GGGCAGTTGGGGAGGGAGCATGG + Intronic
920346111 1:205306728-205306750 CTGCAGGAGAGGTGGGGGCAAGG - Intronic
921167855 1:212519724-212519746 CTGCAGGTGAGGAGTGTGCATGG - Intergenic
922000257 1:221470136-221470158 TGGCAGGTGGGTAGGGAGCAAGG + Intergenic
922259100 1:223920081-223920103 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
922332844 1:224592862-224592884 CTCCAGGTGTGGAAGGAGCCAGG + Intronic
922697823 1:227740451-227740473 GTCCAGGTGTGGAGGGAGGGAGG + Intronic
922803322 1:228373730-228373752 CTGGAGGTGGGGAGGGTGCCTGG + Intronic
922929458 1:229377474-229377496 CTGCAGGGGAGGCGGGAGCTTGG - Intergenic
923076976 1:230618410-230618432 GTGCAGGAGTGGAGGAAGAAGGG - Intergenic
923240726 1:232082958-232082980 CTGCAGATGTGCTGGGAGAATGG + Intergenic
923326995 1:232888774-232888796 CTGCAGGTAAGGAGTGAACAAGG + Intergenic
924101894 1:240612121-240612143 CTGCAGATGTGAAAGGAGCCCGG + Exonic
924340290 1:243022831-243022853 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
924610010 1:245565844-245565866 CTGCAGCTGTACAGGAAGCATGG + Intronic
924909574 1:248496517-248496539 ATGCTGTGGTGGAGGGAGCAGGG + Intergenic
924914528 1:248551543-248551565 ATGCTGTGGTGGAGGGAGCAGGG - Intergenic
924944430 1:248837057-248837079 ATGCAGGTCTGGAGTGATCAGGG - Intergenic
1062786270 10:267837-267859 CAGCATGTGTGCAGGGACCACGG - Intergenic
1063014700 10:2064309-2064331 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
1063502026 10:6563842-6563864 GTGCAGTTGGGGAGGGAGGAAGG + Intronic
1063549584 10:7017684-7017706 CTGCAGTTTGGGATGGAGCAAGG - Intergenic
1063644445 10:7865142-7865164 CTTCAGGAGTGGAGAGGGCAGGG + Intronic
1064008642 10:11717518-11717540 CTGCAGGGGTGGGGTGAGCAGGG + Intergenic
1064553010 10:16521277-16521299 CTGCGGCTGGGGAGGGAGCGCGG + Exonic
1065462404 10:25982553-25982575 CTGCACTGGTGGAGGTAGCAGGG - Intronic
1065722073 10:28636704-28636726 TTGCAAGTGTGCATGGAGCAGGG + Intergenic
1066149872 10:32605228-32605250 CTTCAGGTGTCCAGGAAGCATGG - Intronic
1066155452 10:32672103-32672125 AGGAATGTGTGGAGGGAGCATGG + Intronic
1067004963 10:42651903-42651925 CTTCTGGTGTGGTCGGAGCAGGG - Intergenic
1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG + Intronic
1067463168 10:46473303-46473325 CTGCAGATGAGGCGGTAGCAAGG + Intergenic
1067624025 10:47911335-47911357 CTGCAGATGAGGCGGTAGCAAGG - Intergenic
1067947052 10:50696310-50696332 CAGCAGGTGTGGAGACAGCAGGG - Intergenic
1068627848 10:59268651-59268673 CTGCAGCTGTGGAGATGGCAAGG - Exonic
1068733240 10:60383668-60383690 CTCCAGGTCTCCAGGGAGCATGG - Intronic
1068921482 10:62489296-62489318 CAGCTGGAGTGGAGTGAGCATGG + Intronic
1069334117 10:67328182-67328204 CTGCAGTATGGGAGGGAGCATGG + Intronic
1069551706 10:69368662-69368684 ATGCAGGGGTGTGGGGAGCAGGG + Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070863936 10:79694639-79694661 CTGCAGGTGTGGGCGAAGCCTGG - Intergenic
1070882364 10:79861300-79861322 CAGCAGGTGTGGAGACAGCAGGG - Intergenic
1071499061 10:86190584-86190606 CTGCAGGTGTGCAGGGCCCCTGG + Intronic
1071630834 10:87216865-87216887 CTGCAGGTGTGGGAGAAGCCTGG - Intergenic
1071648934 10:87377611-87377633 CAGCAGGTGTGGAGACAGCAGGG - Intergenic
1072015554 10:91342876-91342898 CCCCATGTGTGGAGGGAGGAGGG - Intergenic
1072321342 10:94253211-94253233 CTGCAGGTGTACAGGAAGCATGG + Intronic
1072617676 10:97060264-97060286 CTGGAAGTGGGAAGGGAGCAGGG - Intronic
1072798349 10:98374068-98374090 CTTCAGGGGCTGAGGGAGCATGG - Intergenic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073338768 10:102729605-102729627 CTGGATGTGTGGCGGTAGCAAGG + Intronic
1073539253 10:104305071-104305093 CTGCAGTTGGGGAGGGAGATTGG + Intergenic
1073989790 10:109249632-109249654 CTTCAGGAGTGGAGAGAGGAGGG + Intergenic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1074958660 10:118418658-118418680 GTGCAGATGTGGAGTGAGCTGGG - Intergenic
1075557981 10:123447198-123447220 CTGCAGCAGTGGAGGTAGCCAGG + Intergenic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076598910 10:131644528-131644550 CTGCCGGTGGAGAGGCAGCACGG + Intergenic
1076618546 10:131772197-131772219 CGCCAGGTGTGGAGGGCACAGGG + Intergenic
1076788417 10:132763320-132763342 GTGGAGGTGAGGAGGCAGCAGGG - Intronic
1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG + Intergenic
1076838442 10:133032819-133032841 CTGCAGGTGTGCAGAGAGCAGGG + Intergenic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077292424 11:1804121-1804143 CGGCAGGTGTGGAGGGCGGCGGG + Intergenic
1077353275 11:2102872-2102894 CATCAGATGTGGAGGGAGCTTGG - Intergenic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1077458509 11:2695701-2695723 CTGCAGGTGGGGACGGAGACAGG - Intronic
1077470743 11:2759406-2759428 CTGCATGTGTGCAGAGGGCAGGG + Intronic
1077477005 11:2795273-2795295 CTGCAGGTCTGGCAGCAGCAGGG - Intronic
1077526621 11:3069732-3069754 CTCCAAGTGTGGAGGGAGCGAGG - Intergenic
1077700690 11:4439319-4439341 TTACAGGTGTGGAGGGAGAGAGG + Intergenic
1078159413 11:8827958-8827980 CTGGAGGTGGGGAGGGGGAACGG + Intronic
1078354658 11:10624834-10624856 CTGCAGGAGTGTAGGGAGTGAGG + Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078997123 11:16713785-16713807 CTGCAGGAGTGGAAGGAGCTGGG - Intronic
1079056153 11:17208083-17208105 CTGCCGGGGTGGCGTGAGCAAGG + Intergenic
1080897115 11:36456027-36456049 AGGCAGCTGTGGAGAGAGCAGGG + Intronic
1081722209 11:45298643-45298665 CTGCTGGTGTGGATGGGCCATGG + Intergenic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1081877532 11:46419804-46419826 ATGAAGGTGGGGAGGGAGGAAGG + Intronic
1083312086 11:61789088-61789110 CTGCAGGGGTGGTGGGTGCTGGG - Exonic
1083312649 11:61792688-61792710 TTTCGGGTGTAGAGGGAGCAGGG + Exonic
1083721354 11:64605140-64605162 CTGCAGGCATGGAGGCAGCCAGG + Intergenic
1083762305 11:64825374-64825396 AGGAAGGTGTGGAGGGAGCGGGG + Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084147057 11:67270553-67270575 CTGCAGGAGTGAAGGAAGGAGGG - Intronic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1084692758 11:70736602-70736624 TAGCAACTGTGGAGGGAGCACGG + Intronic
1084906778 11:72354605-72354627 ATGCAGGTGTGGTGGGAGGGAGG - Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085958170 11:81426883-81426905 CTGCAGGTTTGCAGGAAGCATGG + Intergenic
1086166273 11:83782589-83782611 CTGCAGGTGGAAAGGGAGAAAGG + Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087793656 11:102433025-102433047 CTGCAGGTGTGGAGGCCTCATGG + Intronic
1087807278 11:102568792-102568814 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
1089346908 11:117796751-117796773 CTGCCGCCGTGCAGGGAGCAGGG + Intronic
1089613289 11:119681458-119681480 CTGAAGGTGTGGAGGCAGGCAGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089958885 11:122598429-122598451 CTGCAGGTTTGCAGGGAACGGGG + Intergenic
1090005520 11:122998943-122998965 CTGCTGTTGTGGTGGGAGCAGGG - Intergenic
1090198640 11:124838729-124838751 CTCCAGCAGAGGAGGGAGCAGGG - Intergenic
1090373664 11:126274313-126274335 AGGCAGGAGTGGAGGGAACAAGG + Intronic
1090535644 11:127638340-127638362 GTGCCGGTGTGGGGAGAGCATGG - Intergenic
1090703410 11:129315895-129315917 CAGCAGGTGTGGAGTAAGCTGGG - Intergenic
1090744096 11:129693055-129693077 CTGCAGGACTGCTGGGAGCATGG - Intergenic
1091314644 11:134604949-134604971 CTGCAGATGTACAGGAAGCAGGG + Intergenic
1091446009 12:544458-544480 AGGCAGGTGTGGAGGGAGGTGGG - Intronic
1091670651 12:2449857-2449879 CTGCAGGTGTGGGGTGAGGGTGG + Intronic
1092527159 12:9316208-9316230 CTACTGGGGAGGAGGGAGCAGGG + Intergenic
1092540113 12:9415565-9415587 CTACTGGGGAGGAGGGAGCAGGG - Intergenic
1092693713 12:11144771-11144793 ATGCAGGGGTAGAGGAAGCAGGG - Intronic
1092873614 12:12829417-12829439 TTGCAGGAGTTAAGGGAGCATGG + Exonic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093815656 12:23543132-23543154 CTGCAGTTGTGGAAGGATCCTGG - Intronic
1094031056 12:26011441-26011463 CTGCAGGCAGGGAGGAAGCAAGG - Intronic
1094383852 12:29872641-29872663 CCAATGGTGTGGAGGGAGCATGG + Intergenic
1094512927 12:31106891-31106913 CTACTGGGGAGGAGGGAGCAGGG + Intergenic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1094870556 12:34597060-34597082 CTGCACATGTGCAGGGTGCAGGG + Intergenic
1096758391 12:53818862-53818884 GTCCAGCTGTGGAGGGAGGATGG - Intergenic
1097261145 12:57720863-57720885 CTCCAGGTGGGGAGGGCACAGGG + Exonic
1097586089 12:61517975-61517997 GTGCAGGTGTGGAAGAGGCACGG - Intergenic
1097694688 12:62764869-62764891 CTGCATGTGTGAAGGCCGCATGG + Intronic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1099487777 12:83249485-83249507 CTGCAGGGGTGGAGAGCTCATGG + Intergenic
1099674075 12:85734142-85734164 CTAGAGCTGTGGAGAGAGCATGG - Intergenic
1100335267 12:93623277-93623299 CTGCAGGTGAAGGGGAAGCAAGG - Intergenic
1100670151 12:96802825-96802847 CTGTCGGTGGGTAGGGAGCAGGG - Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1102786805 12:115611681-115611703 GTGCAGGTGGCCAGGGAGCAGGG - Intergenic
1103522737 12:121547254-121547276 CTCGAGGTGGGGAGGGAGCAGGG - Intronic
1103705080 12:122867134-122867156 CGGCTGGTGTGGAGGGAGCCGGG + Exonic
1103768102 12:123297526-123297548 CTACAGGTGTCCAGGAAGCAGGG - Intronic
1104500809 12:129283673-129283695 CTGCAGATGATTAGGGAGCAGGG + Intronic
1104806238 12:131591321-131591343 CCCCAGGTGTGCAGGGGGCAGGG - Intergenic
1104973640 12:132542456-132542478 CTGCTGGTGAGGAGGGGTCAGGG + Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105854966 13:24364740-24364762 CTGCCCGTGGGGAGGGTGCATGG + Intergenic
1105922971 13:24982605-24982627 GTGCATGGGCGGAGGGAGCAGGG - Intergenic
1106477451 13:30110741-30110763 CTGCAGGTGGCAAGGGAGCAAGG - Intergenic
1106607439 13:31242173-31242195 CTGCAAGTCAGGAGGCAGCAAGG - Intronic
1107103034 13:36614475-36614497 CTGAAGGTGTGCAGTGAGGATGG - Intergenic
1107600995 13:42012249-42012271 CTCCAGGAGAGAAGGGAGCAGGG - Intergenic
1107654261 13:42574999-42575021 CTGCAGGTGTGCTGGGGCCACGG + Intronic
1107838932 13:44435857-44435879 CGGCAGCCGTGGAGGGAGAAAGG - Intronic
1108180851 13:47838352-47838374 TTGGAGGCGTGGAGGTAGCAGGG + Intergenic
1110236365 13:73221677-73221699 TAGCAGGTGTGGAGGGCGCAGGG - Intergenic
1110361285 13:74628622-74628644 ATGCAGTTGTGGAGGCAGAATGG + Intergenic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111857060 13:93651679-93651701 CTGGAGGTGAGGAGGAAGCCTGG + Intronic
1112006196 13:95255755-95255777 GTGCAGGTGTGGAGGGGGGTTGG - Intronic
1112227664 13:97555904-97555926 CTGCAGGTGTGGATGGATGGTGG + Intergenic
1114936783 14:27548798-27548820 CTGCAGGTGTGGAGCCCTCATGG + Intergenic
1116044816 14:39731850-39731872 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1118347426 14:64950332-64950354 CGGCAGGTGGGAAGAGAGCAAGG - Exonic
1119112709 14:71990008-71990030 CTGCAGGTGTACAAGAAGCATGG + Intronic
1119348464 14:73944933-73944955 GAGGAGGTCTGGAGGGAGCAGGG - Intronic
1119748577 14:77061839-77061861 CTGCAGGTGGGGCGGGAGTGGGG + Intergenic
1119969356 14:78952102-78952124 CAACAGGTGTGGAAGGTGCAGGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121332818 14:93059270-93059292 AGGCAGGGGTGGAGGGAGTATGG + Intronic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121458130 14:94052199-94052221 TTGGTGGTGTGGAAGGAGCATGG + Intronic
1122136348 14:99635140-99635162 CTGCAGGGGTGGAGGTCCCAGGG + Intergenic
1122436795 14:101706225-101706247 ATGCAGGGGTCGCGGGAGCAGGG + Intergenic
1122606242 14:102948685-102948707 GTGGAGGTGAGGGGGGAGCAGGG + Intronic
1122774562 14:104111530-104111552 CTGCAGGTGTGGTGGCAGGCAGG + Exonic
1123123254 14:105927791-105927813 CCGCAAGCCTGGAGGGAGCATGG - Intronic
1123405904 15:20019295-20019317 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1123515234 15:21025943-21025965 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1124214888 15:27798010-27798032 CAGCAGGTGTGCAGGCACCAGGG + Intronic
1124491872 15:30163160-30163182 CAGCTGGAGTGGATGGAGCATGG + Intergenic
1124635256 15:31361021-31361043 CTGCAGCTGAGGAAGGAGCCAGG - Intronic
1124751664 15:32375157-32375179 CAGCTGGAGTGGATGGAGCATGG - Intergenic
1124838233 15:33216171-33216193 CTCCAGGTCTGGAGAGAGCAGGG + Intergenic
1125592597 15:40864181-40864203 CTGCAGGTCTGCTGGGAGCCAGG + Intergenic
1125833291 15:42730887-42730909 ATTCTGGTGAGGAGGGAGCAGGG - Intronic
1126490756 15:49233147-49233169 CTACAGGTGTACAGGAAGCATGG + Intronic
1126845384 15:52755248-52755270 CTCCAGGGATGGAGGGAGCCGGG - Intergenic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1126954252 15:53914583-53914605 CTGCAGGTGTCGGGGCAGCAGGG + Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128513413 15:68327287-68327309 CTGAAGGGGAGGAGGCAGCAGGG - Intronic
1128529636 15:68435546-68435568 CTGCAGGTGTGGCTGGATCAAGG + Intergenic
1128678656 15:69630142-69630164 CTGCACATGTGTAGGGACCAGGG - Intergenic
1129227614 15:74179147-74179169 CTCCAGGTGTGGAGGTAGGAAGG - Intergenic
1129273061 15:74429437-74429459 CTGCAGAGATGGAAGGAGCATGG - Intronic
1129384953 15:75191350-75191372 CTGCAGCTGTGGAGGAGGCTTGG - Intergenic
1129410448 15:75347895-75347917 TCCCAGGTGTGGAGGGGGCAAGG + Intronic
1129606603 15:77028169-77028191 CTCCAGGGGTGGAGGGAGGAGGG + Intronic
1130655932 15:85792235-85792257 GTGCAGGGGAGGAGGGAGGAGGG - Intronic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1131519195 15:93100478-93100500 CAGCAGCTGTGGGGGGAGCTGGG + Intergenic
1132115404 15:99131992-99132014 CTGCAGATATGGACGGATCAGGG + Exonic
1132253732 15:100355557-100355579 CTGCTCCGGTGGAGGGAGCAGGG - Intergenic
1132301653 15:100779789-100779811 CTGCAGAGGTGGAGAGTGCAAGG - Intergenic
1132550807 16:553176-553198 CTGCAGGGGTGGGGGGGGCATGG - Intronic
1132669007 16:1095130-1095152 CTCCAGGTGTGCAGGGTGCCTGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132909260 16:2299877-2299899 CTTCAGGGCAGGAGGGAGCAAGG + Intronic
1133084028 16:3347523-3347545 GTGGAGGTGTGGACGGAGGAGGG - Intergenic
1134051516 16:11141013-11141035 CTGCTGTTGAGGAGGGAGCCAGG + Intronic
1134626579 16:15726831-15726853 CTGCAGGTGAGGAGGTGGCGCGG - Exonic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135293595 16:21260882-21260904 CTTCAGAGGTGGAGGGGGCAGGG - Intronic
1135391845 16:22100336-22100358 CTGCAGCTGTGGGGGGTGCGGGG - Intronic
1135828131 16:25748443-25748465 CTGCAGGTGTGGGGGTGGGAAGG - Intronic
1136356193 16:29745974-29745996 GTGCAGGCTTGGAGGGTGCAGGG + Exonic
1137484951 16:48882946-48882968 CTGGAGGTGTGGGGGCACCAGGG - Intergenic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138945956 16:61850192-61850214 CAGAAGGTGAAGAGGGAGCAAGG + Intronic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139616463 16:68097179-68097201 TTGGAGGTGGGGAGGGAGAAAGG + Intronic
1139833082 16:69816011-69816033 CTTCAGCTGAGGAGGCAGCAAGG + Intronic
1140196384 16:72859029-72859051 CAGAGGGTGTGGAGGGAGCCTGG - Intronic
1141081474 16:81056847-81056869 GTGCAGGTGTGAAGGGAGCTGGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141206067 16:81933987-81934009 GTGCAGGTTTTGAGGGTGCAGGG + Intronic
1141596457 16:85099990-85100012 AGGCAGGGGTGGTGGGAGCATGG - Intronic
1142190701 16:88716068-88716090 ATCCAGCTGCGGAGGGAGCAGGG - Exonic
1142234385 16:88915007-88915029 GGGCAGGGGTGGAGGGAGGAAGG + Intronic
1142420327 16:89966062-89966084 CAGCAGGGGTGGAGGGGGCCAGG - Exonic
1142453686 16:90202835-90202857 CTGAAGGTGTGCAAGAAGCATGG + Intergenic
1142687520 17:1586213-1586235 CTGAAGTTGAGGATGGAGCACGG + Intronic
1142759526 17:2034750-2034772 CAGCAGGGGAGGGGGGAGCAGGG - Intronic
1143119879 17:4599931-4599953 CTCCAGCTGTGGAGGGGGCAGGG + Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143417094 17:6758219-6758241 CAGCAGGTGAGGAGGCGGCAGGG + Exonic
1143583193 17:7838288-7838310 CTGCTGGTGGGGAGGGAGGGAGG + Intergenic
1143651951 17:8268829-8268851 CTGCCCGTGTGGAGTGCGCACGG + Exonic
1144623840 17:16834454-16834476 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1144882591 17:18438262-18438284 CTGCAGGCATGGTGGGAGCCTGG + Intergenic
1145115905 17:20210782-20210804 GTGGAGGTGTGGTGGGAGCTGGG - Intronic
1145149643 17:20506124-20506146 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1145711468 17:26982630-26982652 CTCCAAGTGTGATGGGAGCAAGG + Intergenic
1146938385 17:36826508-36826530 CTTCAGGTGAGGAGGGGGCCAGG - Intergenic
1147363386 17:39945005-39945027 CAGCAGGTGGGGTGGGAGCAAGG + Intergenic
1147578130 17:41614158-41614180 CTGCAGGCATGGTGGGAGCCTGG - Intronic
1148442938 17:47721144-47721166 CTGGAGGGGTGGAGGGGGAAGGG + Intergenic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148868325 17:50640874-50640896 ATGAAGGCGTGGAGAGAGCAAGG - Intronic
1148994893 17:51700917-51700939 GGGTAGGAGTGGAGGGAGCAGGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151722391 17:75864807-75864829 CTGGAGGAGAGGAGGGACCAGGG + Intergenic
1151903434 17:77032969-77032991 CAGCAGGTGAGGAGGGACCGGGG - Intergenic
1151979599 17:77500669-77500691 CTGCAGGTGGGCAAGAAGCATGG + Intergenic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1152029641 17:77834136-77834158 CTGCTGGGGTGGTGGGGGCAGGG - Intergenic
1152078801 17:78174137-78174159 CTTCAAGTGTGGAGAGGGCAGGG - Exonic
1152286475 17:79415913-79415935 CTGCAGGTGAGGAGGTGGGAGGG - Intronic
1152474401 17:80508704-80508726 GGGCAGGTGGGGAGGGGGCATGG - Intergenic
1152552755 17:81038067-81038089 CTGCAGGTGTTGGGAGGGCAAGG + Intronic
1152600536 17:81260030-81260052 CTGCCTGTGTGCAGGGAACATGG - Intronic
1152732016 17:81977243-81977265 CTGCTGGAGTGGAGGAAGCCGGG + Intronic
1152859887 17:82690212-82690234 CTGCAGAATTGGAGGGAGCACGG + Intronic
1152859909 17:82690370-82690392 CTGCAGAATTGGAAGGAGCATGG + Intronic
1152859917 17:82690450-82690472 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859927 17:82690530-82690552 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859939 17:82690610-82690632 CTGCAGAATTGGAGGGAGCATGG + Intronic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1153276535 18:3373349-3373371 CTGCGGGTGTACAGGAAGCACGG + Intergenic
1153516642 18:5909703-5909725 CTGAAGCTGGGGAGGAAGCAAGG + Intergenic
1153748031 18:8200299-8200321 TTGGAGGTGGGGAGGGAGCTGGG + Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1156632376 18:38985434-38985456 CTGCAGGTGTGGAGTACTCATGG + Intergenic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1157651021 18:49331143-49331165 CTGCAGGTTTGGGAGGAGTAAGG + Intronic
1157840687 18:50955636-50955658 GTGAAGGTGGGGAGGGAGCCAGG - Intergenic
1158068263 18:53439460-53439482 CAGCAAGTGTAGAGGGAGCTAGG - Intronic
1159128444 18:64252690-64252712 CAGCGGGCTTGGAGGGAGCATGG + Intergenic
1159233061 18:65634190-65634212 AGGCAGGTGTGGAGAGAGTATGG + Intergenic
1159289323 18:66395968-66395990 CAGCAGCTGTGGAGGGTGCGCGG + Intergenic
1159626036 18:70696056-70696078 CTACAGATGGGGAGGGAGTAAGG - Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1160015084 18:75134085-75134107 CAGCATGTGTGCTGGGAGCAGGG + Intergenic
1160058152 18:75505740-75505762 GGGCAGGTGTGGAGGGACCTGGG - Intergenic
1160124301 18:76156158-76156180 ATCCTGGTGTGGAGGGAGCTCGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160752591 19:741477-741499 CTGCAGGGGTGAGGGGAGCTGGG + Intronic
1160861741 19:1240123-1240145 CCCCAGGGGTGCAGGGAGCAGGG - Intergenic
1160872219 19:1282593-1282615 GTGAAGGTGTGAAGGGAGGAGGG + Intergenic
1160881838 19:1324524-1324546 CAGCTGGTGTGGCTGGAGCAGGG + Intergenic
1160970505 19:1765810-1765832 CTGCAGTGGTGAGGGGAGCAGGG + Intronic
1161327298 19:3670013-3670035 CAGCAGGTATGGAGGGGGCTGGG + Intronic
1161327328 19:3670096-3670118 CGGCAGGTGGGGAGGGGGCTGGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161811849 19:6475848-6475870 CAGCAGGTGTGGGGGCAGCGTGG + Exonic
1162526940 19:11211673-11211695 AAGGAGGTGAGGAGGGAGCAGGG - Intronic
1163514768 19:17756142-17756164 CCCCAGCTGGGGAGGGAGCAAGG - Intronic
1163636927 19:18441317-18441339 CTGCAGCTGTGGGGGGGGCCTGG - Intergenic
1163690028 19:18733502-18733524 TTACATGAGTGGAGGGAGCAAGG + Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165089105 19:33373538-33373560 CGGCGGGTGTGGCGGGAGCAGGG - Exonic
1165163480 19:33832748-33832770 CTTCCGCTGTGGAGGGGGCATGG - Intergenic
1165290323 19:34878767-34878789 ATGCAGGTGAGGAGGGATCCAGG - Intergenic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165961191 19:39535789-39535811 CTGCATGTGTGCAGGGAGACTGG + Intergenic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1166535131 19:43568765-43568787 CAGGAGTTGGGGAGGGAGCAGGG + Intronic
1166585955 19:43949231-43949253 CAGCAGTGGTGGAGGCAGCATGG + Intergenic
1166750277 19:45161216-45161238 CTGCTGGTGTGGGGGGGACAGGG + Intronic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1166981595 19:46634908-46634930 AGGCAGGTGGGGAGAGAGCAGGG + Intergenic
1167149611 19:47701439-47701461 GGGCAGGTGTGGAGGGGGCTGGG - Exonic
1167431716 19:49459005-49459027 CTGCAGCCGTGGAGGCAGCCAGG + Exonic
1167685215 19:50951686-50951708 CTGCACCTGTGGAGGCAACATGG - Intronic
1167694531 19:51007001-51007023 CTCCAGGTGAGTAGGGAGGAAGG - Intronic
1167712909 19:51123338-51123360 CTGCAGGTGTGGAGGGCCCCAGG + Intergenic
1167720902 19:51179661-51179683 CCACAGGTGTGGAGGAAGCCAGG - Intergenic
1168156219 19:54474196-54474218 CTGCAGGCGTGGGGGGACCGCGG + Intergenic
1168588995 19:57617191-57617213 CTGCAGGTTTGGAGCTAGGAGGG + Intronic
925039345 2:718521-718543 CTGCTGGCTGGGAGGGAGCAGGG - Intergenic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925851966 2:8090740-8090762 CAGCGGGTTTGGAGGGAGCCCGG - Intergenic
926123152 2:10255660-10255682 TTCCTGGTGTGCAGGGAGCAGGG + Intergenic
926221581 2:10939364-10939386 CTGCAGGCGTATAGGAAGCATGG + Intergenic
926629503 2:15123751-15123773 CTGCAGGTGTACAGGAAACAGGG - Intergenic
926737913 2:16088263-16088285 AAGGAGGGGTGGAGGGAGCAAGG + Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
927290405 2:21399525-21399547 CTGCAAGTGTGCAGGGCCCATGG - Intergenic
927695506 2:25236949-25236971 CTGCAGGAGTGTCTGGAGCATGG - Exonic
927759760 2:25742401-25742423 TTGCAGGGGTGGAAGGAGTAGGG + Exonic
928462984 2:31492697-31492719 GTCATGGTGTGGAGGGAGCAGGG + Intergenic
928685376 2:33744334-33744356 CTGCTCCTGTGGAGGTAGCAAGG + Intergenic
928923052 2:36545992-36546014 CTGGAGGGGTGGTGGGAGCAGGG - Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929097332 2:38276207-38276229 CTGCAGATGTGGAAATAGCAAGG - Intergenic
930235425 2:48884588-48884610 CTGCAGGTGTGGTCGGGGGAAGG - Intergenic
930762089 2:55049235-55049257 CAGGAGGTGAGGAGGGAGCCCGG + Intronic
931228599 2:60354836-60354858 CTACAGGTGTGTAGAGAGCAGGG - Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
931803880 2:65785873-65785895 CTGAAAGGGTGGAGGGAGCAAGG + Intergenic
931831979 2:66062213-66062235 TGGCAGGTGTGTAGGGAGCTTGG - Intergenic
931903712 2:66820470-66820492 CTGCAGGAGTGTGTGGAGCATGG - Intergenic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
932559011 2:72851050-72851072 GTGCAGCTGTGGATGGAGCTTGG - Intergenic
933776214 2:85772652-85772674 CAGCTGGTTTGGAGGCAGCAGGG + Intronic
934064899 2:88331452-88331474 CAGCAGGTGGGGAGAGAGAAGGG - Intergenic
934067078 2:88350498-88350520 CTGCAGGTGGAGAGGGAGTGGGG + Intergenic
934561502 2:95315847-95315869 GGGCAGGTCTGGAGGGCGCAGGG - Intronic
934620079 2:95798391-95798413 CTGCAGGTATGGAGCCAGCTGGG + Intergenic
934640808 2:96026166-96026188 CTGCAGGTATGGAGCCAGCTGGG - Exonic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935170323 2:100606511-100606533 CTGCAGAGGTGGAGGAATCACGG + Intergenic
935949674 2:108317265-108317287 CTGCAGGGGTGGAAGTGGCAGGG - Intergenic
936065290 2:109326871-109326893 CAGCAGGTGAGGGGAGAGCAGGG + Intronic
936557355 2:113508300-113508322 CTGGAGGTGGGGGGAGAGCAGGG + Intergenic
937415061 2:121707986-121708008 CTGCTGGTGTGGTCAGAGCAAGG - Intergenic
937699384 2:124846958-124846980 CTGCTGCAGTGGAGGTAGCAGGG + Intronic
937795173 2:126009001-126009023 ATGCATGTGTGGAGGGGGTAGGG + Intergenic
937856024 2:126672536-126672558 CTGCAGGTGCTGAGGGGACAGGG - Intronic
938968000 2:136405275-136405297 TTGCAGGTGTCCAGAGAGCAGGG + Intergenic
941673933 2:168324100-168324122 CAGCAGGTCTGAAGGGACCAGGG + Intergenic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942504371 2:176626266-176626288 GTGGAGGTGTGGAGGCAGCCAGG - Intergenic
943872892 2:193024622-193024644 CCACAGGTGGGGAGGGTGCAAGG - Intergenic
944982120 2:205133417-205133439 CAGTAGGTGTGGAGGGAGCCTGG - Intronic
945406141 2:209451359-209451381 CAGCAGGTGAGAAAGGAGCAAGG + Intronic
945816347 2:214609511-214609533 TTGCAGAAGAGGAGGGAGCAGGG - Intergenic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946201210 2:218071849-218071871 CTGCCTGTGTGTGGGGAGCAGGG - Intronic
946510232 2:220348132-220348154 TTGCAGTTGTTGAGGGAGCATGG + Intergenic
946709562 2:222492268-222492290 CTGCAGGGGTGGAGGCCTCATGG - Intronic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
947792985 2:232878300-232878322 CTGAAGGTGTGAAGGGCCCAGGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948033810 2:234841566-234841588 CTGCAGGTGTGGCGACACCATGG - Intergenic
948368487 2:237473554-237473576 CTGCAGGCGGGGAGGGAGATGGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
948678041 2:239610639-239610661 CTGCAGGTGTGGATGCAGGGAGG + Intergenic
948757053 2:240165964-240165986 CTCCATGTGTGGAGGGAGGGAGG + Intergenic
948860728 2:240751479-240751501 ATTAGGGTGTGGAGGGAGCAAGG - Intronic
948953064 2:241267454-241267476 CCGCAGGGGTGGGGGGACCATGG + Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
949085132 2:242147498-242147520 CTGAAGGTGTGCAAGAAGCATGG + Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1170539141 20:17370791-17370813 CTGCAGTTATGGAGGAGGCAGGG - Intronic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1171193629 20:23179985-23180007 CTGCAGGTGAGGATGGTGCTGGG - Intergenic
1171197611 20:23212630-23212652 CTCCTGGTGTGGAAGGAGCCAGG - Intergenic
1171869566 20:30514239-30514261 CTGCAGGGGAGGGGGGAGGAGGG + Intergenic
1172482609 20:35279820-35279842 CTGCAGGTCAGGGAGGAGCAGGG - Intronic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1173172599 20:40739701-40739723 AGGCAGGTGTGGAGGGAGGCGGG - Intergenic
1173339655 20:42141865-42141887 CTTCAGGTGTTGAGGATGCAGGG - Intronic
1173578969 20:44132835-44132857 CTGCAGGTGTGGGGGGCGGTGGG - Intronic
1173984497 20:47250554-47250576 CCTGAGGTATGGAGGGAGCAGGG - Intronic
1174045596 20:47730355-47730377 ATTCAGGTGTGGAAGGAGAAAGG + Intronic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1174500472 20:50980708-50980730 CTGGAGATGTGGAGTGAGCCGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1175401507 20:58702060-58702082 CAGGAGGTCTGGAAGGAGCAGGG + Intronic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1176056671 20:63152590-63152612 CAGCAGGTGTGTGGGGAGCTGGG + Intergenic
1176212125 20:63929763-63929785 CTGCAGGCGTGGAGTGACCCGGG - Intronic
1176293402 21:5058335-5058357 CTGCAGGGGTGGAGGTTGCAGGG - Intergenic
1176993797 21:15529992-15530014 CTCCACGTGTGGAGGGAGGGAGG + Intergenic
1177284567 21:19033097-19033119 CTGCAGGTGTCAAGGGAGTAGGG + Intergenic
1177607375 21:23398868-23398890 TGGGAGGTGTGGAGAGAGCAGGG - Intergenic
1178943336 21:36925631-36925653 CTGCAGGGGTGGAGGGTGGGGGG + Intronic
1179101096 21:38356165-38356187 CTGCCCCTGCGGAGGGAGCACGG - Intergenic
1179407254 21:41136355-41136377 CTGCAGGGCTGGTGGGAGCCAGG + Intergenic
1179863858 21:44205313-44205335 CTGCAGGGGTGGAGGTTGCAGGG + Intergenic
1180224934 21:46386615-46386637 CTGCAGGTGAGGAGGCACCAAGG - Intronic
1180802535 22:18638528-18638550 GTTCAGGTGTGGGGGAAGCAGGG - Intergenic
1180853771 22:19034084-19034106 GTTCAGGTGTGGGGGAAGCAGGG - Intergenic
1180998000 22:19975027-19975049 GGGCAGGAGTAGAGGGAGCATGG - Intronic
1181165504 22:20980969-20980991 CTGCAGGAGTGAGGGGAGGAGGG - Intronic
1181219188 22:21356733-21356755 GTTCAGGTGTGGGGGAAGCAGGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182357186 22:29727520-29727542 CTGCAGATCTGGTGAGAGCATGG - Intronic
1182574329 22:31262689-31262711 CTGCATGTGAGGAGCGAGCCGGG - Exonic
1182742043 22:32574965-32574987 CTGCTAGTGTGCAAGGAGCAGGG - Intronic
1182973521 22:34600013-34600035 GTGCAGGTGAGGATGGAGCTGGG - Intergenic
1182978206 22:34643143-34643165 CAGCAGATGTGGAGGGAGCCAGG + Intergenic
1183030766 22:35102839-35102861 TTGCAGAGGTGGAGGGAGAAGGG - Intergenic
1183279766 22:36925733-36925755 AAGCAGGTGAGGAGGGAGGAAGG - Intronic
1183343003 22:37292436-37292458 GGGCAGGAGAGGAGGGAGCAGGG + Intronic
1183426970 22:37745454-37745476 CTGCAGGTGAGTAGGGACCGTGG - Intronic
1183673573 22:39287495-39287517 CTGGAGCTGTGGAGGCAGCATGG - Intergenic
1183701425 22:39453371-39453393 CTCCAGGTGGTCAGGGAGCATGG - Intergenic
1183977297 22:41519977-41519999 TTGCAGGGCTGGAGGGAGCCCGG + Intronic
1184251719 22:43264420-43264442 CTGCAGGTCTGGAGACAGCGTGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184850520 22:47116997-47117019 CGGCAGGTGGGCAGGGACCAGGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
1185109022 22:48890529-48890551 CTGCAGGTAAGGAGAGAGCCTGG - Intergenic
1185222416 22:49635816-49635838 CTGCAGGGGTGAGGGGTGCAGGG + Intronic
949516375 3:4810865-4810887 CTGCAGGAGGGCAGGGACCAGGG + Intronic
949606624 3:5660540-5660562 CAGCTGGTGTGGCCGGAGCAGGG + Intergenic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
950406672 3:12809221-12809243 CAGCAGGTGTGTGGGGAGGAAGG + Intronic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
950553641 3:13682423-13682445 GTGAGGGTGTAGAGGGAGCAGGG + Intergenic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950773796 3:15332709-15332731 TTGGAGATGTGGAGGGAGCTGGG - Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952478058 3:33731574-33731596 GTGCAGGTGTAGATGGTGCAGGG - Intergenic
953460284 3:43076468-43076490 CTGTAGGTGGGGTGGCAGCAGGG - Intergenic
953531553 3:43744517-43744539 CTGCAGGGGTGGAGGGGTCCAGG - Intergenic
953927838 3:46991383-46991405 CTGCAGGTGTGGACAGAGATGGG - Intronic
954522608 3:51242752-51242774 CTGCAATGGTGGTGGGAGCAGGG + Intronic
954941388 3:54376192-54376214 CTGCAGGTGTGGAATGGGAAGGG - Intronic
955089270 3:55733143-55733165 GTGCAGGAGAGGAGGGTGCAGGG + Intronic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
956447648 3:69341485-69341507 CTGCAGGAGTGGAGGTGGCAAGG + Intronic
956935541 3:74096640-74096662 CAGCATGGGGGGAGGGAGCATGG + Intergenic
957195851 3:77066968-77066990 TTGCAGGGGTGGAGGGGGGAGGG - Intronic
958543447 3:95510068-95510090 CTGCAGTTGTGCAGAGGGCAAGG + Intergenic
958634785 3:96730003-96730025 CTTCAGAAGTGGAGGAAGCAGGG - Intergenic
959228658 3:103619030-103619052 CTGCAGGTGTGGAGCCCTCATGG - Intergenic
959336907 3:105078735-105078757 TTGCAGGTGAGGGGGAAGCAAGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
961082530 3:124038436-124038458 CAGCAGGTTTGGAGGTGGCAGGG + Intergenic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
961364874 3:126393203-126393225 TTGCCGGTGTGGACAGAGCAGGG - Intergenic
961519265 3:127457218-127457240 CGGCAGGGCTGGCGGGAGCAGGG - Intergenic
961602525 3:128072580-128072602 CAGCAGGTGCAGAGGGAGCGCGG - Intronic
961734937 3:128995410-128995432 CTGCAGGTGGGGTGTGGGCAAGG - Intronic
961863457 3:129936497-129936519 CTGCAGGGGGGAAGGGAGAATGG + Intergenic
962388597 3:134953205-134953227 CTGCAGGTGTCTGGGGAGCAAGG - Intronic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
965901313 3:173644872-173644894 GGGCAGGTGTTGAGGGGGCATGG + Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
967081356 3:186052677-186052699 CTGCAAGTCTGCTGGGAGCATGG - Intronic
967131116 3:186471593-186471615 GTACAGGGGTGGTGGGAGCAAGG - Intergenic
967922807 3:194625328-194625350 CTGCTGGTGTCAAGGAAGCATGG - Intronic
968948106 4:3676081-3676103 CTCCAGCTGGGGAGGAAGCATGG + Intergenic
968961947 4:3750109-3750131 CTGCATGTGTGCAGGAGGCAGGG + Intergenic
969300391 4:6293883-6293905 CAGGAGATGTGGAAGGAGCACGG - Intronic
969321758 4:6417000-6417022 AGGCAGGTGTGGAGGGAGCAGGG - Intronic
969366288 4:6696317-6696339 CCCCAGGTGTGGAGCGAGCATGG - Intronic
969535608 4:7754746-7754768 GGGCAGGTGTGGAGGGTGGAAGG + Intergenic
969643554 4:8413175-8413197 GTGCAGGGGTGGAGGGAGATGGG - Intronic
969966562 4:11002918-11002940 CTGCAGGTGTACAAGAAGCATGG + Intergenic
970134987 4:12912605-12912627 CTGAAGGTGTGAAGGCAGCGTGG + Intergenic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970503491 4:16702920-16702942 GTACAGGTGAGGAGGGTGCATGG - Intronic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
972420011 4:38878242-38878264 ATGCAGCTGTGCAGGGTGCAGGG + Exonic
972565070 4:40262374-40262396 CTGCAGGGGGTCAGGGAGCAGGG - Intergenic
973095405 4:46191989-46192011 TAGAAGGTTTGGAGGGAGCATGG - Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974366533 4:60956910-60956932 TAGCAGATGAGGAGGGAGCAGGG + Intergenic
974628463 4:64453603-64453625 CTGCAGGTGTGGAGCCCTCAGGG - Intergenic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975325133 4:73050729-73050751 TTTCAGGTGTGGAGAGAGGAGGG + Intergenic
975778944 4:77819573-77819595 ATGCAGGTGAGGAGGGGGCGCGG - Intronic
978010427 4:103675584-103675606 CTTCAGGTGTGAAGGGTGAAAGG + Intronic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
979198102 4:117943954-117943976 CTGCAGGTGTACAGGAAGCATGG + Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983795653 4:171859440-171859462 CTTCAGGAAGGGAGGGAGCATGG + Intronic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
985573237 5:661943-661965 CTGGAAGTGTGGAGGGAGAGTGG + Exonic
985602879 5:844019-844041 GGGCAGGTGTGGGGGGCGCAGGG + Intronic
986167239 5:5285279-5285301 CTGCAGGTGGAAAGGCAGCATGG - Intronic
986293966 5:6422244-6422266 CTGGAGCTTTGGAGGGAGCGTGG + Intergenic
986769860 5:10962755-10962777 CTGTAGGTGTGGGGGCGGCAGGG + Intergenic
987099180 5:14577396-14577418 CAGCAGCTGCGGAGGGTGCACGG + Intergenic
987744105 5:21948096-21948118 CTGCAGGGGTGGAGCCATCATGG + Intronic
987861342 5:23491965-23491987 CTGGTGGTGTGGTGGGGGCACGG + Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
991437841 5:66614761-66614783 ATGCAGGTTTGGGGAGAGCAGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994109674 5:95987117-95987139 CTGGAGCTGTGGGGGCAGCAAGG - Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
994597750 5:101860742-101860764 CTCCAGTGGTGGAGGCAGCACGG - Intergenic
995946114 5:117648358-117648380 CTGGAGGTGGGTGGGGAGCAAGG - Intergenic
996031665 5:118712004-118712026 AGGCTGGTGTGGAGGGAGCTAGG - Intergenic
996054693 5:118969520-118969542 CTCCAGGTGTGGGAGGACCAAGG + Intronic
996253161 5:121363402-121363424 CTAGAGGTGTGGAGAGAGGAAGG + Intergenic
997231043 5:132243391-132243413 CTGCTCCTGTGGAGGTAGCAGGG + Intronic
997618072 5:135266293-135266315 CTGGAGATGGGGAGGGAGCTGGG + Intronic
997775626 5:136601861-136601883 CTGCAGGGGTGGAGGCTTCATGG + Intergenic
998153874 5:139773210-139773232 TTGCAGGGGTGGAGGGTGCTGGG - Intergenic
998944887 5:147327837-147327859 CTGCAGCTCTGAGGGGAGCACGG + Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999208508 5:149867856-149867878 TTGCAAGTGGGGTGGGAGCAGGG - Intronic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
999692288 5:154158526-154158548 CTGCATGTGTAGGGAGAGCAGGG - Intronic
1000152887 5:158520423-158520445 CAGCAGGTGTGGAGCTAGTATGG + Intergenic
1000357930 5:160418894-160418916 CCTCAGGTGTTGAGGGAGCGAGG - Intronic
1001482230 5:172096345-172096367 CTGCTGGTGTGGGAGGGGCAGGG - Intronic
1001634927 5:173202998-173203020 CTGCTGGAGAGGAGGGAGAAGGG - Intergenic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1001780549 5:174365238-174365260 ATGGAGGTGTGGAGGTGGCAGGG + Intergenic
1002049286 5:176560847-176560869 CAGCAGGTCTGTGGGGAGCATGG + Intronic
1002612787 5:180432313-180432335 CAGCAGCTGTGGAGGGTGCGTGG + Intergenic
1002681629 5:180969684-180969706 CAGCAGCTGTGGAGGGTGCGTGG - Intergenic
1002737263 5:181404321-181404343 CTGAAGGTGTGCAAGAAGCATGG + Intergenic
1003179893 6:3782509-3782531 CTGCCAGTGTGGAAGGAGCTGGG + Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1003311309 6:4971999-4972021 CTGCAGGCCTGGAGGGAGTGGGG + Intergenic
1003901600 6:10660033-10660055 CAGTAGATGTGGAGGGTGCACGG + Intergenic
1004029494 6:11852449-11852471 GTGGAGGAGAGGAGGGAGCAGGG + Intergenic
1004851090 6:19699823-19699845 CTCCAGGTGGGGAGGTAGCCAGG - Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005986880 6:30881227-30881249 CTGGAGGTGTGTTGGGAGGAGGG + Intronic
1006133799 6:31883789-31883811 CTGCAGGTGAGTAGGGGGCCCGG - Exonic
1006220282 6:32484170-32484192 CTGCAGTTGTGGGGAGGGCATGG + Intergenic
1006408360 6:33857901-33857923 ATTCAGGTGTGGAGGGGGCTGGG - Intergenic
1006638269 6:35475319-35475341 CTGCAGGTATGGGGGCAGCAGGG - Exonic
1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG + Intronic
1006807756 6:36799552-36799574 CTGCAGGCGGGGAGGCTGCAGGG + Intronic
1006897321 6:37479418-37479440 CTGCAGGTGTGGCTGGACCTGGG + Intronic
1007932839 6:45707921-45707943 CTGCTGGTGTGGCTGGAGCCCGG + Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1007966919 6:46011878-46011900 CTGCAAGTGAGGAAGGAGCCAGG + Intronic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1012525320 6:100170202-100170224 CTGAAGGGGTGGAGGGGGAAGGG - Intergenic
1013310000 6:108884856-108884878 CGTAAGGTGTGAAGGGAGCACGG + Intronic
1013639574 6:112060068-112060090 TGGCTGGTGTGGAGGCAGCAAGG + Intronic
1014057123 6:117028954-117028976 CTTCATGGGTGGAGGGAGCAAGG + Intergenic
1014520711 6:122439094-122439116 CTGCAGGTGTGGAGAGTGCAAGG + Intergenic
1015899920 6:138053720-138053742 CTGCAGCAGTGGAGGTAGCAGGG - Intergenic
1016216262 6:141607649-141607671 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1016455650 6:144227888-144227910 CAGCAGGTGTGGAGTGAGCCAGG - Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1016833559 6:148455573-148455595 GTCTAGGTGTGGAGGGCGCATGG + Intronic
1016938253 6:149464495-149464517 CTGCAGGAGTCTAGGGAGTAGGG - Intronic
1017548571 6:155479442-155479464 CTGCACTTGTGGAGGGAGGGAGG + Intergenic
1017740952 6:157406183-157406205 CTGCAGTTGGGGAGGGAGTGGGG + Intronic
1018163314 6:161069403-161069425 TTCCAGGTGGGGAGGCAGCATGG + Intronic
1018349070 6:162937366-162937388 GTGCAGGTGTAGAGAGAGAAGGG + Intronic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1018837803 6:167498330-167498352 GTGCAGGTGAGGAGGGGGAAGGG - Intergenic
1019242358 6:170679877-170679899 CTGAAGGTGTGCAAGAAGCATGG + Intergenic
1019658892 7:2212698-2212720 CTGCAGCTGTACAGGAAGCATGG - Intronic
1019716016 7:2539726-2539748 TCGCAGGGGTGGAGGCAGCAGGG - Intronic
1019755178 7:2763465-2763487 CTGCCGGGGTTGAGGGAGCTCGG - Intronic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1020690951 7:11353877-11353899 CTGTAAGTTTTGAGGGAGCAAGG + Intergenic
1021543598 7:21788563-21788585 CTGCTGGTGGGGAGAGAGGAAGG - Intronic
1023709663 7:42978000-42978022 CTGCAGCTGTTCAGGTAGCATGG - Intergenic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024715086 7:52069857-52069879 CTGCATCTGTGAAGGGACCAGGG - Intergenic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1027035275 7:74920636-74920658 GTGGAGGGGTGGAGGGAGTAAGG - Intergenic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028457443 7:91053834-91053856 CTGCAGGTGTGGTCTGTGCAGGG - Intronic
1029394778 7:100300504-100300526 GTGGAGGGGTGGAGGGAGTAAGG + Intergenic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1030310132 7:108060410-108060432 CTGCAGGTGTGGGGAGTGGAGGG + Intronic
1031480792 7:122276160-122276182 CTGCAGCTGTACAGGAAGCATGG - Intergenic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033270883 7:139931876-139931898 CAGGAGGTGTGGAGGGGTCATGG + Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033494063 7:141876500-141876522 CTACAGTGGTGGAGGCAGCAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034724410 7:153321980-153322002 CTGGATGTGAGGAGAGAGCATGG - Intergenic
1034742927 7:153495257-153495279 CTGCAGGGGTGGAGCCTGCATGG + Intergenic
1034902092 7:154914199-154914221 CTGCAGGTGTAGGGAGAGCCGGG + Intergenic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035185831 7:157125373-157125395 ATGCAAGTGTGGAGGGAGGGAGG - Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035505759 8:128277-128299 CTGAAGGTGTGCAAGAAGCATGG - Intergenic
1035754923 8:2023852-2023874 CTGCAGGGGAGGAAGCAGCAGGG + Intergenic
1036007029 8:4676608-4676630 CTGCAGGTGCGAAAGGAGAATGG - Intronic
1036652431 8:10653974-10653996 CAGCAGCTGGGGAGGGAGCCTGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037584759 8:20268769-20268791 CTGCTGGTGGGTTGGGAGCAGGG + Intronic
1037739976 8:21600999-21601021 CTGGAAGTGTGGAGGGTGAAGGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1037907661 8:22724930-22724952 GTGCCGGTGGGGAGGGAGCCTGG + Exonic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1038644068 8:29348954-29348976 CTGCAGGTGTGGCGGGCGCCAGG + Intronic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041730397 8:61056614-61056636 TCACAGGTGTGGAGAGAGCAGGG - Intergenic
1042645482 8:70982027-70982049 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1042920539 8:73915043-73915065 CCGCAGGTTGGGAGGGAGCAAGG + Intergenic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1045113100 8:98951811-98951833 CTGCAGGTGCGGCTGCAGCAAGG - Exonic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1048188707 8:132268096-132268118 TAGCTGGTGGGGAGGGAGCATGG - Intronic
1048299396 8:133240098-133240120 CAGCAGCGTTGGAGGGAGCAAGG + Intronic
1048583461 8:135750204-135750226 CTGCTGGTGTGGGGGAAGCAGGG + Intergenic
1049099401 8:140568427-140568449 CTGCTGCTGAGGAGGGAGCGAGG + Intronic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049258890 8:141628240-141628262 CTGGAGGGGTGGAGGCTGCAGGG + Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049895648 9:108999-109021 CTGGAGGTGGGGGGAGAGCAGGG - Intergenic
1050121575 9:2313966-2313988 CTGCAGGGGTGGAGCGTTCATGG + Intergenic
1050878042 9:10666018-10666040 ATGCAGGTGTGGAGAGAGACAGG + Intergenic
1051086002 9:13349748-13349770 CTGCATGTGTGGGGGGGACAGGG - Intergenic
1052077548 9:24161638-24161660 CTCCACGTGTGAAGGGAGGAAGG - Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1052454632 9:28680138-28680160 GAGCAGGTGTGGTGGGTGCAGGG - Intergenic
1053177703 9:35940588-35940610 GTGCAGGTGTGGGAGGAGAAAGG - Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1055829078 9:80359060-80359082 CTGCAGGTGCGGAGACAGCAAGG + Intergenic
1056019876 9:82430501-82430523 CAGCAGGTGTGGAGACAGCAGGG + Intergenic
1056397936 9:86198410-86198432 CTGCAGCTGTACAGGAAGCATGG - Intergenic
1056575967 9:87856380-87856402 CAGCAGGTGTGGAGACAGCAGGG + Intergenic
1056664579 9:88571581-88571603 CTGCGCGTGTGGAGTGGGCAGGG + Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057009596 9:91589725-91589747 TTGGCGCTGTGGAGGGAGCAGGG + Intronic
1057071964 9:92106529-92106551 CAGCAGGTGTGGAGACAGCAGGG - Intronic
1057208749 9:93188170-93188192 CTGCAGGTGCTGCGGGAGTAGGG - Intronic
1057318105 9:93984575-93984597 GGGGAGGTGGGGAGGGAGCAAGG + Intergenic
1057325551 9:94060576-94060598 CTGCAGGTGTACAGGAAGCATGG + Intronic
1057820936 9:98330106-98330128 ATGCAGGGCTGGAGGGAGCTTGG - Intronic
1057873313 9:98734062-98734084 GGGCATGTGTGGAGGCAGCACGG - Exonic
1058381733 9:104384300-104384322 CTGCAGGTGTGGTTGGAGGGAGG - Intergenic
1058523081 9:105831419-105831441 CTGCAGGTGTACAGGAGGCATGG + Intergenic
1058948037 9:109877079-109877101 CTGCTGGTGTGGAGACAGCCAGG + Intronic
1059638138 9:116190676-116190698 ATGCTGGTGTGGAGGGGCCATGG + Intronic
1060020828 9:120129726-120129748 CTGCAGGTTTTGAGAGAGCAGGG - Intergenic
1060093359 9:120764563-120764585 CTGGTGTTGTGGAAGGAGCACGG - Exonic
1060482117 9:124022775-124022797 CTGCAGCTGCGGGGGGAGCCGGG + Intronic
1060484787 9:124040188-124040210 ATGCAGGGCTGGAGGGGGCAGGG + Intergenic
1060701130 9:125748874-125748896 CTGCAGGCGGGGAGGGGGCCCGG + Intronic
1060859703 9:126944396-126944418 GTGGAGGCGTGTAGGGAGCAGGG - Intronic
1060985091 9:127815228-127815250 GTTCAGGTGTGGAGGCCGCAGGG + Exonic
1061061865 9:128254503-128254525 CTGCAGGTGTGGGTGTGGCAAGG - Intronic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061251027 9:129426461-129426483 CTGCACCTGTGGAGTGAGCAAGG - Intergenic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061424918 9:130492824-130492846 CTGCAGGTCTGGGGGGTGCAGGG + Intronic
1061577970 9:131519481-131519503 CTGCAGGTGAGGAGCGGCCAGGG + Exonic
1061903900 9:133686699-133686721 CAGCAGGTGTTGAGGCTGCAGGG + Intronic
1062078090 9:134603051-134603073 CTGCTGGTGTGGTGCGAGGATGG + Intergenic
1062083741 9:134637913-134637935 CTGCTGGTGTGCAGGCTGCACGG + Intergenic
1062181834 9:135195136-135195158 CTGCAGGTCTGGGGGGTACATGG - Intergenic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1062352118 9:136144316-136144338 CTGCAGGTCTGGAGAGAGGCTGG + Intergenic
1062386595 9:136314304-136314326 CAGCAGGAGGGCAGGGAGCAGGG - Intergenic
1062459116 9:136655500-136655522 TGGCAGGGCTGGAGGGAGCACGG + Intergenic
1062715864 9:138009811-138009833 CTGGAGGTGAGGATGGAACAGGG + Intronic
1203602549 Un_KI270748v1:29101-29123 CTGAAGGTGTGCAAGAAGCATGG + Intergenic
1185645140 X:1610532-1610554 CTGGAGGTTTGGCTGGAGCAGGG - Intergenic
1185907063 X:3944855-3944877 AGGAAGGCGTGGAGGGAGCAAGG - Intergenic
1185930254 X:4194924-4194946 GTGCAGATTTGGTGGGAGCAGGG - Intergenic
1186816289 X:13241055-13241077 GGACACGTGTGGAGGGAGCAGGG + Intergenic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1187180530 X:16939458-16939480 CTACAGGTGTGCAGAGTGCAAGG - Intergenic
1188148028 X:26638491-26638513 CAGAAGGTGAGGAGGAAGCAAGG + Intergenic
1188716540 X:33465383-33465405 CTGCAGGTGCCCAGGGAGCATGG - Intergenic
1188807986 X:34614875-34614897 CTCCAGGTGTTGAGGGAGGGTGG - Intergenic
1188985979 X:36768725-36768747 CTTCATGTGTGGATGGTGCATGG - Intergenic
1189277521 X:39797546-39797568 CTGCAGGTCTGGCTGGAGAAAGG + Intergenic
1189302638 X:39963490-39963512 CTTCAGGTGTGGTGTGATCAGGG - Intergenic
1189376019 X:40466879-40466901 CTGCCGGGGAGGTGGGAGCAAGG + Intergenic
1189957133 X:46287459-46287481 GTGGAGGTGTGGAGGCAGCCAGG - Intergenic
1190118515 X:47641386-47641408 CTGCAGCTGCTGAGAGAGCAAGG - Exonic
1190322724 X:49188051-49188073 GTGGAGGTGTGGAGGGAGGGAGG + Exonic
1190387617 X:49898180-49898202 CTGCAGGGGTGGAGTGCTCATGG + Intergenic
1190731704 X:53230871-53230893 CTGGAGGGGTGGAGGGAGTGAGG + Intergenic
1191823687 X:65340271-65340293 CAGCAGTAGTGGAGGCAGCATGG - Intergenic
1193406443 X:81107499-81107521 CTGCAGGTGTGGAGCCCTCATGG + Intergenic
1193541825 X:82781941-82781963 CTGCAGGGGTGGAGGCTTCATGG - Intergenic
1193702648 X:84781516-84781538 CTGAAGGTGAGGGGGAAGCAAGG + Intergenic
1194982337 X:100453350-100453372 CTGCAGGGGTGGAGCCATCATGG + Intergenic
1195068525 X:101258541-101258563 CTGCAGGTGAGGATGGAGACAGG + Exonic
1195676852 X:107513165-107513187 TAGCAGGTCAGGAGGGAGCAGGG - Intergenic
1196197650 X:112852884-112852906 AGGCAGGAGGGGAGGGAGCAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197712228 X:129679498-129679520 CTGCTGGAGTGGCGGGATCATGG + Intergenic
1198313479 X:135443748-135443770 CTGCAGCTGTACAGGAAGCATGG + Intergenic
1198433122 X:136587820-136587842 CTACAGGTGTTGGGGGAGAAGGG + Intergenic
1199871474 X:151902292-151902314 CTGCAGGGGTGGAGAGAGGCTGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic