ID: 1056929264

View in Genome Browser
Species Human (GRCh38)
Location 9:90861178-90861200
Sequence CCAAGTCCCACAGGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056929257_1056929264 0 Left 1056929257 9:90861155-90861177 CCTCCACTGGGACCTCGAACTCC 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG No data
1056929253_1056929264 19 Left 1056929253 9:90861136-90861158 CCATTTCGTGCCTTTTCAGCCTC 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG No data
1056929252_1056929264 20 Left 1056929252 9:90861135-90861157 CCCATTTCGTGCCTTTTCAGCCT 0: 1
1: 0
2: 2
3: 13
4: 177
Right 1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG No data
1056929258_1056929264 -3 Left 1056929258 9:90861158-90861180 CCACTGGGACCTCGAACTCCCCA 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG No data
1056929256_1056929264 9 Left 1056929256 9:90861146-90861168 CCTTTTCAGCCTCCACTGGGACC 0: 1
1: 0
2: 2
3: 38
4: 269
Right 1056929264 9:90861178-90861200 CCAAGTCCCACAGGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056929264 Original CRISPR CCAAGTCCCACAGGTCTTCC AGG Intronic
No off target data available for this crispr