ID: 1056929278

View in Genome Browser
Species Human (GRCh38)
Location 9:90861234-90861256
Sequence ACGTGGCATGCACTGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056929272_1056929278 -4 Left 1056929272 9:90861215-90861237 CCCATGAGTCATAAGCCTTACGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data
1056929267_1056929278 27 Left 1056929267 9:90861184-90861206 CCCACAGGTCTTCCAGGGGATCT 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data
1056929270_1056929278 0 Left 1056929270 9:90861211-90861233 CCTCCCCATGAGTCATAAGCCTT 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data
1056929269_1056929278 15 Left 1056929269 9:90861196-90861218 CCAGGGGATCTCTCACCTCCCCA 0: 1
1: 0
2: 1
3: 29
4: 303
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data
1056929273_1056929278 -5 Left 1056929273 9:90861216-90861238 CCATGAGTCATAAGCCTTACGTG 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data
1056929271_1056929278 -3 Left 1056929271 9:90861214-90861236 CCCCATGAGTCATAAGCCTTACG 0: 1
1: 0
2: 0
3: 0
4: 50
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data
1056929268_1056929278 26 Left 1056929268 9:90861185-90861207 CCACAGGTCTTCCAGGGGATCTC 0: 1
1: 0
2: 2
3: 14
4: 200
Right 1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056929278 Original CRISPR ACGTGGCATGCACTGCAGTG GGG Intronic
No off target data available for this crispr