ID: 1056931538

View in Genome Browser
Species Human (GRCh38)
Location 9:90881905-90881927
Sequence CTGCCTGACGACTGCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056931537_1056931538 -3 Left 1056931537 9:90881885-90881907 CCACGGCAAAAATCTGGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1056931538 9:90881905-90881927 CTGCCTGACGACTGCTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056931538 Original CRISPR CTGCCTGACGACTGCTCCGC AGG Intronic
No off target data available for this crispr