ID: 1056932475

View in Genome Browser
Species Human (GRCh38)
Location 9:90890360-90890382
Sequence CACCAGGGGCAGACCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056932460_1056932475 30 Left 1056932460 9:90890307-90890329 CCTCTGTCCTCCATGGACGCACG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG No data
1056932461_1056932475 23 Left 1056932461 9:90890314-90890336 CCTCCATGGACGCACGTAACAGT 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG No data
1056932463_1056932475 20 Left 1056932463 9:90890317-90890339 CCATGGACGCACGTAACAGTGGG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056932475 Original CRISPR CACCAGGGGCAGACCGGGGA GGG Intronic
No off target data available for this crispr