ID: 1056936701

View in Genome Browser
Species Human (GRCh38)
Location 9:90920059-90920081
Sequence CGACCCGTTTCCCGAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056936701_1056936702 -6 Left 1056936701 9:90920059-90920081 CCAAGCTCTCGGGAAACGGGTCG No data
Right 1056936702 9:90920076-90920098 GGGTCGCTCTGTTCCTCTCTTGG No data
1056936701_1056936705 11 Left 1056936701 9:90920059-90920081 CCAAGCTCTCGGGAAACGGGTCG No data
Right 1056936705 9:90920093-90920115 TCTTGGGCCTCCCACAGCCCTGG No data
1056936701_1056936710 22 Left 1056936701 9:90920059-90920081 CCAAGCTCTCGGGAAACGGGTCG No data
Right 1056936710 9:90920104-90920126 CCACAGCCCTGGAACAGTCTGGG No data
1056936701_1056936713 30 Left 1056936701 9:90920059-90920081 CCAAGCTCTCGGGAAACGGGTCG No data
Right 1056936713 9:90920112-90920134 CTGGAACAGTCTGGGTGCCCTGG No data
1056936701_1056936703 -5 Left 1056936701 9:90920059-90920081 CCAAGCTCTCGGGAAACGGGTCG No data
Right 1056936703 9:90920077-90920099 GGTCGCTCTGTTCCTCTCTTGGG No data
1056936701_1056936708 21 Left 1056936701 9:90920059-90920081 CCAAGCTCTCGGGAAACGGGTCG No data
Right 1056936708 9:90920103-90920125 CCCACAGCCCTGGAACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056936701 Original CRISPR CGACCCGTTTCCCGAGAGCT TGG (reversed) Intergenic