ID: 1056937956

View in Genome Browser
Species Human (GRCh38)
Location 9:90932217-90932239
Sequence AACAGGACCAGTAATGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056937952_1056937956 15 Left 1056937952 9:90932179-90932201 CCTCAGGTTCTCCTCGAAATATT No data
Right 1056937956 9:90932217-90932239 AACAGGACCAGTAATGGCAGAGG No data
1056937951_1056937956 16 Left 1056937951 9:90932178-90932200 CCCTCAGGTTCTCCTCGAAATAT No data
Right 1056937956 9:90932217-90932239 AACAGGACCAGTAATGGCAGAGG No data
1056937953_1056937956 4 Left 1056937953 9:90932190-90932212 CCTCGAAATATTGTAAGTGAGTC No data
Right 1056937956 9:90932217-90932239 AACAGGACCAGTAATGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056937956 Original CRISPR AACAGGACCAGTAATGGCAG AGG Intergenic