ID: 1056938059

View in Genome Browser
Species Human (GRCh38)
Location 9:90933018-90933040
Sequence CATTTTGTCCAGAATTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056938055_1056938059 10 Left 1056938055 9:90932985-90933007 CCTACTGGATTTGGAGGTCTACA No data
Right 1056938059 9:90933018-90933040 CATTTTGTCCAGAATTTGGAAGG No data
1056938054_1056938059 11 Left 1056938054 9:90932984-90933006 CCCTACTGGATTTGGAGGTCTAC No data
Right 1056938059 9:90933018-90933040 CATTTTGTCCAGAATTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056938059 Original CRISPR CATTTTGTCCAGAATTTGGA AGG Intergenic
No off target data available for this crispr