ID: 1056938525

View in Genome Browser
Species Human (GRCh38)
Location 9:90936381-90936403
Sequence AATGATGCAGAGCAGGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056938517_1056938525 4 Left 1056938517 9:90936354-90936376 CCGAGGCACCCAGGAAAAACCTC No data
Right 1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG No data
1056938513_1056938525 25 Left 1056938513 9:90936333-90936355 CCTGCACACGTGCACAAGCTCCC No data
Right 1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG No data
1056938520_1056938525 -4 Left 1056938520 9:90936362-90936384 CCCAGGAAAAACCTCGGGCAATG No data
Right 1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG No data
1056938521_1056938525 -5 Left 1056938521 9:90936363-90936385 CCAGGAAAAACCTCGGGCAATGA No data
Right 1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG No data
1056938516_1056938525 5 Left 1056938516 9:90936353-90936375 CCCGAGGCACCCAGGAAAAACCT No data
Right 1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056938525 Original CRISPR AATGATGCAGAGCAGGCTTT GGG Intergenic
No off target data available for this crispr