ID: 1056941674

View in Genome Browser
Species Human (GRCh38)
Location 9:90961544-90961566
Sequence GCTGTCGGCAGAAACGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056941674_1056941683 18 Left 1056941674 9:90961544-90961566 CCTGGAGCGTTTCTGCCGACAGC No data
Right 1056941683 9:90961585-90961607 GCACCCGCTTTGCAGGTTCTGGG No data
1056941674_1056941678 11 Left 1056941674 9:90961544-90961566 CCTGGAGCGTTTCTGCCGACAGC No data
Right 1056941678 9:90961578-90961600 GCCCCAAGCACCCGCTTTGCAGG No data
1056941674_1056941682 17 Left 1056941674 9:90961544-90961566 CCTGGAGCGTTTCTGCCGACAGC No data
Right 1056941682 9:90961584-90961606 AGCACCCGCTTTGCAGGTTCTGG No data
1056941674_1056941686 26 Left 1056941674 9:90961544-90961566 CCTGGAGCGTTTCTGCCGACAGC No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056941674 Original CRISPR GCTGTCGGCAGAAACGCTCC AGG (reversed) Intergenic
No off target data available for this crispr