ID: 1056941678

View in Genome Browser
Species Human (GRCh38)
Location 9:90961578-90961600
Sequence GCCCCAAGCACCCGCTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056941676_1056941678 -4 Left 1056941676 9:90961559-90961581 CCGACAGCATGACCATGCGGCCC No data
Right 1056941678 9:90961578-90961600 GCCCCAAGCACCCGCTTTGCAGG No data
1056941674_1056941678 11 Left 1056941674 9:90961544-90961566 CCTGGAGCGTTTCTGCCGACAGC No data
Right 1056941678 9:90961578-90961600 GCCCCAAGCACCCGCTTTGCAGG No data
1056941673_1056941678 12 Left 1056941673 9:90961543-90961565 CCCTGGAGCGTTTCTGCCGACAG No data
Right 1056941678 9:90961578-90961600 GCCCCAAGCACCCGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056941678 Original CRISPR GCCCCAAGCACCCGCTTTGC AGG Intergenic
No off target data available for this crispr