ID: 1056941686

View in Genome Browser
Species Human (GRCh38)
Location 9:90961593-90961615
Sequence TTTGCAGGTTCTGGGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056941679_1056941686 -9 Left 1056941679 9:90961579-90961601 CCCCAAGCACCCGCTTTGCAGGT No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data
1056941676_1056941686 11 Left 1056941676 9:90961559-90961581 CCGACAGCATGACCATGCGGCCC No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data
1056941674_1056941686 26 Left 1056941674 9:90961544-90961566 CCTGGAGCGTTTCTGCCGACAGC No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data
1056941680_1056941686 -10 Left 1056941680 9:90961580-90961602 CCCAAGCACCCGCTTTGCAGGTT No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data
1056941673_1056941686 27 Left 1056941673 9:90961543-90961565 CCCTGGAGCGTTTCTGCCGACAG No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data
1056941677_1056941686 -1 Left 1056941677 9:90961571-90961593 CCATGCGGCCCCAAGCACCCGCT No data
Right 1056941686 9:90961593-90961615 TTTGCAGGTTCTGGGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056941686 Original CRISPR TTTGCAGGTTCTGGGCATGA TGG Intergenic
No off target data available for this crispr