ID: 1056946853

View in Genome Browser
Species Human (GRCh38)
Location 9:91005026-91005048
Sequence CTGCAGGGATAGGTGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056946853_1056946862 -8 Left 1056946853 9:91005026-91005048 CCGAGCTCCACCTATCCCTGCAG No data
Right 1056946862 9:91005041-91005063 CCCTGCAGGGGTGTTTGGATGGG No data
1056946853_1056946860 -9 Left 1056946853 9:91005026-91005048 CCGAGCTCCACCTATCCCTGCAG No data
Right 1056946860 9:91005040-91005062 TCCCTGCAGGGGTGTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056946853 Original CRISPR CTGCAGGGATAGGTGGAGCT CGG (reversed) Intergenic
No off target data available for this crispr