ID: 1056949032

View in Genome Browser
Species Human (GRCh38)
Location 9:91027161-91027183
Sequence GACCCCATGCTTCTTCCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056949032_1056949036 -5 Left 1056949032 9:91027161-91027183 CCGACGGGAAGAAGCATGGGGTC No data
Right 1056949036 9:91027179-91027201 GGGTCGGGCAAAACTTGCATGGG No data
1056949032_1056949035 -6 Left 1056949032 9:91027161-91027183 CCGACGGGAAGAAGCATGGGGTC No data
Right 1056949035 9:91027178-91027200 GGGGTCGGGCAAAACTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056949032 Original CRISPR GACCCCATGCTTCTTCCCGT CGG (reversed) Intergenic
No off target data available for this crispr