ID: 1056955418

View in Genome Browser
Species Human (GRCh38)
Location 9:91077200-91077222
Sequence ACTCCATGGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 2, 1: 3, 2: 51, 3: 163, 4: 755}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056955410_1056955418 22 Left 1056955410 9:91077155-91077177 CCAAGATCGAGGGACCAGCATCT No data
Right 1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG 0: 2
1: 3
2: 51
3: 163
4: 755
1056955413_1056955418 8 Left 1056955413 9:91077169-91077191 CCAGCATCTGGCGAGGCCTTCTT No data
Right 1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG 0: 2
1: 3
2: 51
3: 163
4: 755
1056955414_1056955418 -8 Left 1056955414 9:91077185-91077207 CCTTCTTGCTGCATTACTCCATG No data
Right 1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG 0: 2
1: 3
2: 51
3: 163
4: 755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056955418 Original CRISPR ACTCCATGGCAGAAGGTGGA AGG Intergenic
900723921 1:4202302-4202324 ATCCCATGGTGGAAGGTGGATGG + Intergenic
901468661 1:9440525-9440547 ATCCCATGGCAGAAGACGGACGG + Intergenic
901704348 1:11062043-11062065 ACTGCATGGGGGAAAGTGGAGGG + Intergenic
902521731 1:17021791-17021813 ACCCCATGGCAAAAGGCAGAAGG - Intronic
902826270 1:18976452-18976474 AATCCCAGGCAAAAGGTGGAAGG + Intergenic
903084548 1:20843801-20843823 ACTGGAGGACAGAAGGTGGAAGG - Intronic
904549368 1:31302703-31302725 AACTCATGGCAGAAGGTGAAGGG + Intronic
904631494 1:31846138-31846160 AAATCATGGCAGAAGGTGAAGGG + Intergenic
905339100 1:37266174-37266196 TCACCATGGCAGGAGGTGGCAGG - Intergenic
905472130 1:38201146-38201168 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
905491807 1:38350163-38350185 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
905627986 1:39501041-39501063 AATTCATGGCAGAAAGTGGAAGG + Intronic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
905776997 1:40674742-40674764 ATTCCATGGCAGCAGGTGAAGGG - Intergenic
906435668 1:45794340-45794362 GCTGCATGGCAGAAGGTGAGTGG + Intronic
906911324 1:49954470-49954492 ATCTTATGGCAGAAGGTGGAAGG - Intronic
907126429 1:52055090-52055112 TCTCCATGGCAGTAGGTGCGCGG + Exonic
907292007 1:53421295-53421317 ACTCCATTGAGGAAGGTGGAAGG - Intergenic
907485911 1:54777994-54778016 AAATCATGGCAGAAGGTGAAGGG - Intergenic
907962065 1:59293398-59293420 ATCCCATGGCAGAAGGTGAGAGG + Intergenic
908407593 1:63830421-63830443 AAATCATGGCAGAAGGTGAAGGG + Intronic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
908932147 1:69330619-69330641 CCATCATGGCAGAAGGTGAAGGG + Intergenic
909313934 1:74190973-74190995 GCATCATGACAGAAGGTGGAAGG - Intronic
909468714 1:76002820-76002842 ATTCCATGGCAGACGGTGGAAGG + Intergenic
910060786 1:83089176-83089198 ATTCCATGGCAGAAGGCAGAAGG - Intergenic
910414513 1:86983356-86983378 AAATCATGGCAGAAGGTGAAGGG + Intronic
910927067 1:92408590-92408612 ATTCCATGGTGGAAGGTGGAAGG - Intergenic
911145451 1:94548101-94548123 TCTCCATGGCAGAAGGGACAAGG + Intergenic
911534223 1:99080359-99080381 ATTTCATGCTAGAAGGTGGAAGG + Intergenic
911731731 1:101298510-101298532 ACTCTATGTCAGAACTTGGATGG + Intergenic
912095707 1:106140293-106140315 AAACCATGGCAGAAGGTAAAAGG - Intergenic
912240945 1:107907728-107907750 ATACCATGGTGGAAGGTGGAAGG - Intronic
912445413 1:109732279-109732301 GCTCCAGGGCAGCAGGAGGAGGG + Intronic
912488976 1:110050792-110050814 ACTCCATCCCAGAAGCTGGCAGG - Intronic
912709153 1:111937426-111937448 ACTCCCTGGGGGAAGGTGGGTGG + Intronic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
913228886 1:116724556-116724578 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
913298485 1:117345409-117345431 ACTCCATGTCACAATGTAGAGGG + Intergenic
913686255 1:121234843-121234865 ATCCCATGGCAGAAGGCAGAAGG - Intronic
914038106 1:144022465-144022487 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
914151348 1:145045475-145045497 ATCCCATGGCAGAAGGCAGAAGG + Intronic
914453670 1:147815884-147815906 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
916314174 1:163429063-163429085 ATGCCATGCCACAAGGTGGAGGG + Intergenic
916359233 1:163949476-163949498 CCATCATGGCAGAAGGTGAAGGG - Intergenic
916443449 1:164849670-164849692 ATTCCATGCCAGAGGGAGGATGG - Exonic
916460952 1:165023736-165023758 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
917068771 1:171126343-171126365 AAATCATGGCAGAAGGTGAAAGG - Intergenic
917172214 1:172189776-172189798 CCACCATGGCAGAAGGTGAAAGG + Intronic
917871211 1:179243663-179243685 GTCTCATGGCAGAAGGTGGAAGG - Intergenic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
918070806 1:181132120-181132142 ACTGCCTGGCAGATGGAGGAGGG + Intergenic
918189758 1:182162848-182162870 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
918668339 1:187179611-187179633 AAATCATGGCAGAAGGTGAAGGG + Intergenic
918929353 1:190834187-190834209 ATTCCATGGTAGAGGGTGGAAGG - Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919344996 1:196363670-196363692 ATCCCATGGCAGAAGGCAGAAGG - Intronic
919830630 1:201538419-201538441 AGTCCCTGGAAGAAGGAGGAGGG + Intergenic
919885134 1:201928073-201928095 AATCCATGGCAGTAGGCAGAAGG - Intronic
919992115 1:202715225-202715247 ACTTCATTGCAGAAGGAAGAAGG - Intergenic
920165398 1:204032122-204032144 AGTCCATGGCAGCAGGTGCCTGG + Intergenic
920206079 1:204292992-204293014 GCTCCATGCCAGGAGGAGGAAGG - Intronic
920434857 1:205941097-205941119 CATCCATGGCAGGAGGAGGAAGG + Intronic
920473577 1:206253402-206253424 ATCCCATGGCAGAAGGCAGAAGG - Intronic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922066843 1:222152398-222152420 ACTCCATGGTGGAAGGTGAGAGG - Intergenic
922203674 1:223428534-223428556 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
922332598 1:224590564-224590586 ATCACATGGCAGAAGGTGGAAGG + Intronic
922377847 1:224987550-224987572 GTTCCATGGAAGAAGGTAGAAGG + Intronic
922850730 1:228731662-228731684 AGTTCATGGAAGAAGGAGGAAGG + Intergenic
923034715 1:230277632-230277654 ACTCCAGGTGAGCAGGTGGACGG + Intronic
923621292 1:235581593-235581615 AAATCATGGCAGAAGGTGAAGGG - Intronic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
924262803 1:242249278-242249300 ATTTCATGGCAGAAGGTGGAAGG - Intronic
1063498598 10:6532671-6532693 TCTCCAGAGCAGAAGGTAGATGG + Intronic
1064311307 10:14213946-14213968 ACAGCATGGCAGAAGTTGAAAGG - Intronic
1064326934 10:14360023-14360045 ATCTCATCGCAGAAGGTGGAAGG + Intronic
1064328787 10:14374803-14374825 ACTCCATGGCAGGAAGAGAAGGG + Intronic
1064350656 10:14573340-14573362 ATCCCATGGTGGAAGGTGGAAGG - Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1064934464 10:20664403-20664425 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1066058800 10:31704555-31704577 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1066132400 10:32407298-32407320 ATTCCGTGGCAGAAGGTGTAAGG - Intergenic
1066148396 10:32587359-32587381 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1066179719 10:32948704-32948726 ATCCCATGGTAGAAGGTGGAAGG - Intronic
1066277414 10:33882332-33882354 ATCTCATGGCAGAAGGTGGAAGG + Intergenic
1066629737 10:37447373-37447395 ATCTCATGGAAGAAGGTGGAAGG - Intergenic
1066725435 10:38387652-38387674 ATTTCATGGCAGAAGGTGGAAGG + Intergenic
1067141674 10:43663065-43663087 CCCTCATGGCAGAAGGTGAAGGG + Intergenic
1067196652 10:44125825-44125847 ACTCAATGGCAGTCAGTGGAGGG - Intergenic
1067465317 10:46493992-46494014 ATCCCATGATAGAAGGTGGAAGG + Intergenic
1067476652 10:46571815-46571837 TACTCATGGCAGAAGGTGGAAGG - Intergenic
1067618086 10:47769965-47769987 TACTCATGGCAGAAGGTGGAAGG + Intergenic
1067621870 10:47890609-47890631 ATCCCATGATAGAAGGTGGAAGG - Intergenic
1068046909 10:51897772-51897794 ACTGCATGACAGAGGATGGAGGG - Intronic
1068540882 10:58293883-58293905 AACTCATGGCAGAAGGTGAAGGG + Intergenic
1068852970 10:61765555-61765577 CATCCATTGCAGATGGTGGAGGG + Intronic
1069412098 10:68164246-68164268 ATTCCATGGCAGAAGGCAGAAGG + Intronic
1069467618 10:68655849-68655871 ACTTCATGGCAGAAGGTGAGTGG + Intronic
1069808651 10:71142353-71142375 ACTCCATGGTAGAAGGCAAATGG + Intergenic
1070578841 10:77703397-77703419 ACCACATGGCAGAAGGTGGGAGG - Intergenic
1070587706 10:77779237-77779259 AGTCCATGTCAGTAGGGGGAGGG - Intergenic
1070939808 10:80334590-80334612 ATCCCATGGCTGAAGGTGGAAGG + Intergenic
1071177701 10:82945539-82945561 GTTCTATGGCAGAAGGGGGAAGG + Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071873578 10:89819974-89819996 AAATCATGGCAGAAGGTGAAAGG + Intergenic
1071991312 10:91103138-91103160 GCCCCAAGGCAGAGGGTGGAGGG + Intergenic
1072797849 10:98369990-98370012 GGTCCAAGGCAGGAGGTGGACGG - Intergenic
1073332341 10:102678767-102678789 AGCCCAAAGCAGAAGGTGGAGGG + Intronic
1073387187 10:103135421-103135443 GCATCATGGCAGAAGGTGAAAGG - Intronic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1073624737 10:105085264-105085286 TCAACATGGCAGAAGGTGGGCGG + Intronic
1074590691 10:114810169-114810191 GTCCCATGGCAGAAGGTGGGAGG + Intergenic
1074656394 10:115593102-115593124 ATCCCATGGCAGAAGGCAGAAGG + Intronic
1074965708 10:118489163-118489185 AAATCATGGCAGAAGGTGAAAGG - Intergenic
1075161135 10:120025574-120025596 ATCCCATGGCGGAAGGTGGATGG + Intergenic
1075210184 10:120484457-120484479 ATCCCATGGCAGAAGGTGAGAGG + Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075620112 10:123920880-123920902 ATCCCATGGTGGAAGGTGGAAGG - Intronic
1076043573 10:127272780-127272802 CCATCATGGCAGAAGGTGAAGGG + Intronic
1076493275 10:130878526-130878548 ACCCCATGGCAGAAGGTGAGAGG + Intergenic
1076990771 11:272418-272440 TCTCCAAGGCCGCAGGTGGAAGG - Intergenic
1077782948 11:5351813-5351835 ACTCCATGACAGAAAGAGTATGG - Exonic
1077850074 11:6067456-6067478 ACTCCATGGCAGAGAATGCATGG + Intergenic
1078093190 11:8280311-8280333 ATCCCATGGCAGAAGGTAGAAGG + Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078514586 11:12010505-12010527 ACCGCATGGTAGAAGGTGTAAGG - Intergenic
1078517812 11:12039712-12039734 GATTCATGGCAGAAGGTGAAAGG + Intergenic
1078584533 11:12570988-12571010 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1078756599 11:14216605-14216627 ATCCCATGGCAGAAGGCAGAAGG + Intronic
1079399123 11:20091561-20091583 ACTCCATGGCAGAAGGTGGGAGG - Intronic
1079688394 11:23391655-23391677 TCTCCCTGCCAGAAGGAGGAGGG + Intergenic
1079706218 11:23622694-23622716 ATCCCATGGCAGAAGATGGAAGG + Intergenic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1080577212 11:33610889-33610911 ATCCCATGGCAGAAGGCAGAGGG + Intronic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1080843465 11:36005806-36005828 AAATCATGGCAGAAGGTGAAGGG + Intronic
1081071043 11:38608660-38608682 TACTCATGGCAGAAGGTGGAGGG + Intergenic
1081182087 11:39996329-39996351 ATGCCATGGTGGAAGGTGGAAGG - Intergenic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1081530944 11:43958968-43958990 AACACATGGCAGAAGGTAGAAGG + Intergenic
1082776788 11:57251457-57251479 ATCCCATAGCAGAAGGTGGAAGG + Intergenic
1082776910 11:57252505-57252527 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1082927730 11:58568659-58568681 AGACCATGGAAGAAGCTGGAAGG + Intronic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1083523855 11:63342433-63342455 CATCCCTGGAAGAAGGTGGAAGG + Intronic
1083552003 11:63597158-63597180 CCATCATGGCAGAAGGTGAAGGG - Intronic
1083708455 11:64532519-64532541 ATCTCATGGCAGAAGGTGGAAGG + Intergenic
1083732681 11:64661232-64661254 GCTGCAGGGCACAAGGTGGAGGG - Intronic
1084104245 11:66970632-66970654 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1084776271 11:71378739-71378761 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1085554123 11:77404018-77404040 ATTCCGTGGTAGAAGGTGGAAGG - Intronic
1085959233 11:81440170-81440192 CTTACATGGCAGCAGGTGGAAGG + Intergenic
1086034012 11:82394935-82394957 AACTCATGGCAGAAGGTGAAAGG - Intergenic
1086115844 11:83249130-83249152 AGTCCCTGCCACAAGGTGGAGGG - Intronic
1086935605 11:92742665-92742687 ATTCCATGGTGGAAGGTGGAAGG - Intronic
1087147484 11:94826525-94826547 ACAACATGGCAGAAGGTCAAAGG + Intronic
1087401765 11:97675866-97675888 CTAACATGGCAGAAGGTGGAAGG + Intergenic
1087497182 11:98906793-98906815 CCGTCATGGCAGAAGGTGAAGGG - Intergenic
1087509147 11:99068058-99068080 AAATCATGGCAGAAGGTGAAGGG - Intronic
1087829868 11:102807989-102808011 CCTCCACGGCGGAAGGTGGCAGG + Intergenic
1088731234 11:112685196-112685218 AAACCATGGCAGAAGCTGCAAGG - Intergenic
1089082475 11:115788305-115788327 GTTCCATGGCAGGAGGAGGAGGG + Intergenic
1089107901 11:116029947-116029969 ATTCCATGGCAGAAGGTGGAAGG - Intergenic
1089728009 11:120500046-120500068 ACTGCATCTCTGAAGGTGGAGGG - Intergenic
1090137057 11:124209812-124209834 GCTCCTGGGCAGAAGGTGGCGGG - Intergenic
1090729323 11:129556015-129556037 CTCCCATGGCAGAAGGTGAAAGG - Intergenic
1090805642 11:130200393-130200415 CATCCATGGCAGAAGGTGAAGGG + Intronic
1090924264 11:131235854-131235876 ACTCCTTGACAGAAGGTGACTGG + Intergenic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1091244782 11:134082619-134082641 TAACCATGGCAGAAGGTGAAAGG - Intronic
1091294302 11:134462076-134462098 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1091490132 12:925798-925820 TCTCCATGTCAGGAGGTGGCTGG - Intronic
1092508083 12:9124799-9124821 ACTCCTGGGCAGAAGGGGGCAGG + Intergenic
1092925427 12:13267959-13267981 CAACCATGGCAGAAGGTGAAGGG + Intergenic
1093009702 12:14093663-14093685 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1093038994 12:14358113-14358135 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
1093487840 12:19671284-19671306 ATTTCATGGCAGAAGGTGAGAGG + Intronic
1094128137 12:27045288-27045310 CAACCATGGCAGAAGGTGAAGGG + Intronic
1094738701 12:33264102-33264124 CCTCTATGGCATAAGGTGGAAGG - Intergenic
1095213835 12:39526005-39526027 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1095633234 12:44402083-44402105 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1095648854 12:44582963-44582985 ATCCCATGGCAGAAGTTAGAAGG - Intronic
1095872249 12:47042143-47042165 AATCCAAGGAAGAAGGGGGAAGG - Intergenic
1096174183 12:49501312-49501334 ATTCCATGGCAGATGGCAGAAGG + Intronic
1096768822 12:53918816-53918838 ATCACATGGCAGAAGGTGGAAGG + Intergenic
1096908298 12:54956819-54956841 ATCCCATGGCGGAAGATGGAGGG + Intronic
1097335433 12:58377517-58377539 CAGCCATGGCAGAAGGTGAAGGG - Intergenic
1097533748 12:60839108-60839130 TCTGCATGGCAGAAGGCAGAAGG + Intergenic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1097689732 12:62723575-62723597 TTCACATGGCAGAAGGTGGAAGG - Intronic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098559415 12:71855070-71855092 ACTTCATGGCAGAAGGCGAAGGG + Intronic
1098601498 12:72336693-72336715 ATCCCATGGCAGAAAGTGGAAGG + Intronic
1098651772 12:72979587-72979609 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1098755801 12:74361829-74361851 ATATCATGGCAGAAGGTGAAGGG - Intergenic
1098965286 12:76781595-76781617 ATCCCATGGTAGAAGGTGCAAGG - Intronic
1098986740 12:77020380-77020402 AATCCATGGCAGAAGGCGAAAGG + Intergenic
1099204554 12:79712329-79712351 AACTCATGGCAGAAGGTGAAGGG - Intergenic
1099513775 12:83570393-83570415 TTTCCATGGCAGAAAGTGGAAGG + Intergenic
1099621663 12:85009121-85009143 CTCCCATGGCAGAAGGTGAAAGG + Intergenic
1099668590 12:85661067-85661089 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1099722437 12:86381931-86381953 CAACCATGGCAGAAGGTGAAAGG - Intronic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1100234050 12:92639837-92639859 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1100333704 12:93609918-93609940 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1100916714 12:99432094-99432116 ACAACATGGCAGAAGGTCAAAGG - Intronic
1100962365 12:99976963-99976985 ATCCCATGGCAGAAGGCAGAAGG + Intronic
1101049122 12:100842732-100842754 CTTACATGGTAGAAGGTGGAAGG + Intronic
1101075896 12:101129594-101129616 ACTCCAGGGGAAACGGTGGAAGG + Intergenic
1101103337 12:101416994-101417016 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1101451701 12:104785702-104785724 ATCCCATGGTGGAAGGTGGAGGG + Intergenic
1102247583 12:111365059-111365081 ACTCCTTGGGGGAAGGTGGATGG - Intronic
1102712605 12:114941359-114941381 TATCCATGGCAGTAGGTGAAGGG + Intergenic
1103209685 12:119157219-119157241 ACTTCATGGCTGCACGTGGATGG + Exonic
1103234174 12:119358385-119358407 ATCCCATGGTGGAAGGTGGAAGG - Intronic
1104115806 12:125748048-125748070 ACATCATGACAGAAGGTGAAGGG - Intergenic
1104157310 12:126146119-126146141 ATCCCATGGCAGAAGGCTGAGGG + Intergenic
1104288062 12:127443447-127443469 ACACCCTGGCAGAGGGAGGAAGG + Intergenic
1104513044 12:129399031-129399053 ATCCCATGGCAGGATGTGGAAGG + Intronic
1104572697 12:129938972-129938994 TCATCATGGCAGAAGGTGAAAGG + Intergenic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1105446990 13:20466017-20466039 CACCCATGGCAGAAGGTGAAGGG - Intronic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1105771774 13:23618924-23618946 CTTACGTGGCAGAAGGTGGAAGG - Intronic
1105801481 13:23906792-23906814 TATTCATGGCAGAAGGTGCAGGG + Intergenic
1106199795 13:27526843-27526865 ACAACATGGCAGAAGGTCAAAGG - Intergenic
1106404373 13:29461133-29461155 ATACCATGGCAGAAGGCAGAAGG + Intronic
1106875657 13:34069657-34069679 ACTCCATGGCAGAAGGCAGGAGG - Intergenic
1107019279 13:35735085-35735107 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1107043757 13:35974648-35974670 CAACCATGGCAGAAGGTGAAAGG - Intronic
1107260547 13:38485425-38485447 ATCCCATGGCAGAAGGTAGAAGG + Intergenic
1107391087 13:39965028-39965050 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1107880569 13:44828847-44828869 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1108005621 13:45943089-45943111 ATCCCATGGCAGAAAGTGGAAGG - Intergenic
1108112416 13:47089885-47089907 ACTCCATGGCTAAAGGTGGAAGG + Intergenic
1108642716 13:52397441-52397463 ACTCCTTGGACGAAGGTGCATGG + Exonic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109198585 13:59406537-59406559 ATTCCATGGCAGAAGGTAAGAGG - Intergenic
1109306866 13:60650653-60650675 ATCCCATGGCATCAGGTGGAAGG - Intergenic
1109349002 13:61152676-61152698 ATTCCATGGCAGAAGGCAGATGG - Intergenic
1109579460 13:64307932-64307954 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1110051265 13:70902664-70902686 ATTCCATGGCGGAAGGTAGAAGG - Intergenic
1110237038 13:73227806-73227828 ACATCATGGTAGAAGGTGGAAGG + Intergenic
1110372621 13:74756685-74756707 TCTACATGGCAGAAGGCAGAAGG + Intergenic
1110754199 13:79152393-79152415 ACTGCATGGCATAAGGTGAGTGG + Intergenic
1110885504 13:80628929-80628951 AATTCATGGCAGAAGGTGAAGGG - Intergenic
1111073709 13:83204922-83204944 ATTCCATGGCAGAAAGTGAAAGG + Intergenic
1111221213 13:85207535-85207557 GAATCATGGCAGAAGGTGGAGGG - Intergenic
1111333073 13:86786371-86786393 ATCTCATGGCGGAAGGTGGAAGG + Intergenic
1111778770 13:92695047-92695069 ACATTATGGCAGAAGGTGAAGGG - Intronic
1111807813 13:93059636-93059658 CAACCATGGCAGAAGGTGAAAGG - Intergenic
1112144016 13:96678092-96678114 ATTCCCTGGCAGAAAGTGGAAGG + Intronic
1112248351 13:97754821-97754843 CCCACCTGGCAGAAGGTGGAGGG + Intergenic
1112295051 13:98179169-98179191 AATCCATGGTAGAAGGTGAAAGG + Intronic
1112460120 13:99596520-99596542 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1113045141 13:106147373-106147395 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1113205086 13:107907676-107907698 CACCCATGGCAGAAGGTGAAGGG - Intergenic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1113888221 13:113672118-113672140 GCTCCCTGGCTGACGGTGGAGGG - Intronic
1114187864 14:20416718-20416740 TTCTCATGGCAGAAGGTGGAAGG - Intergenic
1114901658 14:27068009-27068031 ATCCCGTGGCAGAAGGTGGAAGG + Intergenic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1115326968 14:32150523-32150545 ATTCCATGACCGAAGGTGGAAGG + Intronic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116091172 14:40308574-40308596 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1116420523 14:44727034-44727056 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1116693562 14:48142730-48142752 AATGGATGGCAGAAGCTGGAAGG - Intergenic
1116966691 14:51022349-51022371 ATCCCATGGCAGAAGGCAGAAGG - Intronic
1117241678 14:53839898-53839920 ATTCCATGACAGAAGGCAGAAGG + Intergenic
1117286952 14:54295030-54295052 ATCTCATGGCAGAAGATGGAAGG + Intergenic
1117514315 14:56485398-56485420 CTTACATGGCAGAAGATGGAAGG + Intergenic
1117966183 14:61209131-61209153 ATCCCATGGCGGAAGATGGAAGG - Intronic
1118039620 14:61902758-61902780 CCATCATGGCAGAAGGTGAAAGG + Intergenic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1118051203 14:62030061-62030083 TCTTCATGGAAGAAGGTGGGAGG - Intronic
1118270453 14:64338378-64338400 ACTCCAGAGCAGAACGCGGAGGG + Intergenic
1118388603 14:65277811-65277833 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
1118627340 14:67671781-67671803 ACCCCATGGCAGAAGATGGAAGG + Intronic
1118782561 14:69018664-69018686 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1118867989 14:69718285-69718307 AGTCCATGGTAGAAGCTGGCTGG + Intergenic
1119036156 14:71231725-71231747 ACTCCTGGGCAGAAGGGGGCTGG + Intergenic
1119240934 14:73058974-73058996 ACTCCGCGGCGGAACGTGGAAGG - Intronic
1119604328 14:76001799-76001821 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1120235530 14:81886276-81886298 ATCTCATGGCAGAAAGTGGAAGG - Intergenic
1120502768 14:85317563-85317585 ATTCCATGGCTAAAGGTGGAAGG + Intergenic
1120703544 14:87724551-87724573 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
1120994890 14:90409587-90409609 ACTCCTTGGCAGAGAGTTGAGGG - Intergenic
1121211880 14:92213388-92213410 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1121220649 14:92282620-92282642 ATCACATGGCAGAAGGTGGAAGG - Intergenic
1121420984 14:93814069-93814091 ATTCCATGGCAGAAGGTGGAAGG + Intergenic
1121461875 14:94086238-94086260 CGATCATGGCAGAAGGTGGAAGG - Intronic
1121676159 14:95754702-95754724 ACTCCATGGCAAGATGTGAAGGG - Intergenic
1121821342 14:96969945-96969967 ACACCATGGATGAAGCTGGAGGG + Intergenic
1122352814 14:101106233-101106255 AAATCATGGCAGAAGGTGAAAGG - Intergenic
1122422608 14:101587034-101587056 ATGCCAAGGCAGAAGGTGGGGGG + Intergenic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1122448488 14:101784443-101784465 CCATCATGGCAGAAGGTGAAGGG + Intronic
1122848185 14:104512270-104512292 ACTGCATGGCAGCTGGTGGGCGG - Intronic
1123064786 14:105612155-105612177 ACAGCATAGCAGAAGGTGAAGGG - Intergenic
1123811879 15:23935214-23935236 ACTCAATAGCAGAAGGTAAAGGG - Intergenic
1123836145 15:24195219-24195241 TCTCCATGGCTGCAGGAGGAGGG - Intergenic
1124134007 15:27018020-27018042 ATTCCCTGCCAGATGGTGGAAGG + Intronic
1124183220 15:27498196-27498218 ACTCCATGCCAGGTGGTGGAGGG - Intronic
1124389433 15:29240552-29240574 ATCCCATGGCAGAAGGTGAAAGG - Intronic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124858120 15:33410708-33410730 ACAGCATGGCAGTGGGTGGAAGG + Intronic
1125291972 15:38159221-38159243 ATTCCATGGTGGAAGGTGGAAGG - Intergenic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126508034 15:49430642-49430664 ATTCCATGGTGGAAGGTAGAAGG + Intronic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127805601 15:62517167-62517189 ACTCCAAGGCACAAAGTGGGAGG - Intronic
1128564062 15:68687769-68687791 ATCCCATGGCAGAAGGTGGAGGG + Intronic
1128732351 15:70029751-70029773 ACTGCTTGGCAGAAGGTGAAAGG + Intergenic
1128808822 15:70555287-70555309 ACTCCATGGCTGCAGGGAGATGG + Intergenic
1128924032 15:71637566-71637588 AGTCTATGGCAGAAGGTTAAAGG + Intronic
1129057097 15:72827954-72827976 ACTTCATGGCAGCTGGAGGATGG + Intergenic
1129069932 15:72942332-72942354 ACCCCATGGCAGAAAGTTGAAGG + Intergenic
1129080352 15:73033842-73033864 ACTTCCTAGCATAAGGTGGAAGG + Intergenic
1129279963 15:74476906-74476928 CCAACATGGCAGAAGGTGAAAGG + Intergenic
1129785970 15:78310369-78310391 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
1130120782 15:81045831-81045853 CAACCATGGCAGAAGGTGAAGGG - Intronic
1131949059 15:97661024-97661046 ATTCCATGATGGAAGGTGGAAGG - Intergenic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1132077094 15:98830942-98830964 TATTCATGGCAGAAGGTGAAGGG + Intronic
1132425326 15:101710970-101710992 AATTCAGGGCAGGAGGTGGACGG + Intronic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1134359605 16:13518867-13518889 ATTCCATGGTGGGAGGTGGAAGG + Intergenic
1135650298 16:24200631-24200653 ATCCCATGGCAGAAGGTGAAGGG + Intronic
1135754339 16:25083843-25083865 ATCCCATGGTGGAAGGTGGACGG - Intergenic
1135841339 16:25879424-25879446 ACATCATGGCAGAAGGTGAAAGG + Intronic
1135847687 16:25933739-25933761 CAACCATGGCAGAAGGTGAAAGG + Intronic
1135899461 16:26443528-26443550 TTCACATGGCAGAAGGTGGAGGG - Intergenic
1137358790 16:47793108-47793130 AAGTCATGGCAGAAGGTGAAAGG + Intergenic
1137865465 16:51891246-51891268 ATCGCATGACAGAAGGTGGAAGG + Intergenic
1138331772 16:56221109-56221131 CTCCCATGGCAGAAGGTAGAAGG - Intronic
1138889418 16:61123987-61124009 AATCCTTGCTAGAAGGTGGAAGG - Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140059861 16:71559194-71559216 ACCACATGGCAGAAGGTGAAGGG - Intronic
1140348018 16:74233795-74233817 CTCCTATGGCAGAAGGTGGATGG - Intergenic
1140391747 16:74593053-74593075 ATCCCATGGCAGAATGTGGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141222836 16:82087800-82087822 GTTCCACAGCAGAAGGTGGAAGG + Intronic
1141509962 16:84505535-84505557 ACTCCAGGGCAGAAGCCAGAAGG - Intronic
1142252951 16:89001118-89001140 ACACCAGGGCAGAAGCTGGATGG - Intergenic
1142552188 17:747624-747646 TCTGCATGGCAGATGGTGGTGGG + Exonic
1142744380 17:1948389-1948411 ACTCCAGGGCTGAAGGCCGAGGG + Intronic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1143643572 17:8214475-8214497 CCCCCATTTCAGAAGGTGGAAGG - Intergenic
1143695307 17:8610702-8610724 ATTCCATGGGAGAAGGCGGAAGG - Intronic
1144006580 17:11105904-11105926 AATCCACGTCAGAAGGTGGCTGG - Intergenic
1146200418 17:30852664-30852686 AACTCATGGCAGAAGGTGAAGGG + Intronic
1146567231 17:33923915-33923937 ACTACATGGCAGAAGATACAGGG + Intronic
1147457534 17:40547591-40547613 CCACCATGGCAGCAGGTGGAGGG - Intergenic
1147584390 17:41645390-41645412 ATCCCATGGCAGGAGGTGGAAGG - Intergenic
1150162687 17:62912566-62912588 ATCCCACGGCAGAAGGTGGAAGG - Intergenic
1150449646 17:65256189-65256211 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1150470370 17:65432079-65432101 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1151082553 17:71345357-71345379 ATTCCATGGCAGAAGATGGAAGG - Intergenic
1151265545 17:72952472-72952494 GCTCCATGGCAGCAGGGGGGTGG - Intronic
1151403585 17:73872270-73872292 ACTCCATGGAGGAAGTTGGTGGG - Intergenic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1152507030 17:80756241-80756263 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1153462688 18:5353902-5353924 ATCCCATGGTAGAAGATGGAAGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155234395 18:23804885-23804907 AACCCATGGCAGAAGGTAAAGGG - Intronic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1155868585 18:30997340-30997362 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1156441929 18:37199245-37199267 ACCAGATGGCAGAAGGTGGGAGG - Intronic
1157694169 18:49707795-49707817 ACTGCAGGGCAGAAGCTGGCTGG - Intergenic
1157700528 18:49759252-49759274 ACTCCAGGGGAGAAGGTGGTAGG + Intergenic
1157781497 18:50443911-50443933 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1157861206 18:51142292-51142314 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1157897151 18:51479999-51480021 AATCCATGTCAGAGGCTGGATGG + Intergenic
1157910220 18:51610472-51610494 CAACCATGGCAGAAGGTGAATGG + Intergenic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158015477 18:52777864-52777886 TATCTATGGCAGAAGGTAGATGG + Intronic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1158465103 18:57682870-57682892 ACTCCATCACCGAAGCTGGAGGG + Intronic
1158490970 18:57909493-57909515 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1158750310 18:60251642-60251664 ATCCCATGGCAGGAGGTGGAAGG - Intergenic
1159628869 18:70726294-70726316 AACTCATGGTAGAAGGTGGAAGG + Intergenic
1160080222 18:75719588-75719610 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1160103059 18:75941899-75941921 ATCCCATGGCAGAAGGTGACAGG + Intergenic
1160919881 19:1514345-1514367 AGTCCAGGTCAGAAGGTGGGGGG - Intergenic
1162013349 19:7830770-7830792 AGATCAGGGCAGAAGGTGGACGG - Intronic
1162105806 19:8368976-8368998 ACAGCATGGCAGGAGGAGGATGG + Intronic
1164787628 19:30946200-30946222 TCACCATGGCAGTGGGTGGAGGG + Intergenic
1164858546 19:31544335-31544357 TACTCATGGCAGAAGGTGGAGGG + Intergenic
1164889870 19:31814219-31814241 ATCCCATGGCAGAAAGTGGGAGG - Intergenic
1165218101 19:34291537-34291559 ACCCCAAGGCGAAAGGTGGAAGG + Intronic
1165546244 19:36538844-36538866 AAATCATGGCAGAAGGTGAAGGG - Intronic
1165963602 19:39555770-39555792 ATCCCATGGCAGAAGGAGAAAGG - Intergenic
1166164222 19:40975827-40975849 ACTCCAGTACAGAAGATGGAAGG - Intergenic
1166186611 19:41143542-41143564 ACTCCAGTACAGAAGATGGAAGG + Intergenic
1166499660 19:43331311-43331333 ACTCCCTGGGAGAGGGTGGGAGG - Intergenic
1166651666 19:44579767-44579789 TCATCATGGCAGAAGGTGAAGGG - Intergenic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
925251418 2:2442151-2442173 ATTGCATGGCAGACAGTGGAAGG + Intergenic
925303154 2:2831116-2831138 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
925767608 2:7251764-7251786 TTCCCATGGCAGATGGTGGAAGG - Intergenic
926520919 2:13912023-13912045 ACACCATGGCAGAAGGTGAAGGG - Intergenic
926851509 2:17203212-17203234 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
927303029 2:21537640-21537662 AAAACATGGCAGAAGGTGAAGGG + Intergenic
927599740 2:24430474-24430496 ATCCCATGGCAAAAGGTGGAAGG - Intergenic
927776372 2:25906990-25907012 ACCCCATGGCAGAAGGCAGAAGG - Intergenic
928334946 2:30389983-30390005 ACTCCTTGGAAGATGGTTGATGG - Intergenic
928393699 2:30928446-30928468 ACACCATGGCAGAGGGGGGATGG - Intronic
928425011 2:31170667-31170689 ACTCCATGGCAGATCCTGCAGGG + Intergenic
928811342 2:35231064-35231086 CATTCATGGCAGAAGGTGAAGGG - Intergenic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
929346928 2:40895654-40895676 CTACCATGGTAGAAGGTGGAAGG + Intergenic
929699787 2:44152109-44152131 ATCCCCTGGCAGAAGGTGAAAGG - Intergenic
930032488 2:47066982-47067004 ATCCCATGGCGGAAGGTGGAGGG + Intronic
930511660 2:52352875-52352897 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
931704481 2:64935995-64936017 TACTCATGGCAGAAGGTGGAGGG - Intergenic
931831190 2:66053178-66053200 CATCCATGGCAGAAGGCAGAGGG + Intergenic
931838106 2:66121015-66121037 ATCCTATGGAAGAAGGTGGAAGG + Intergenic
932562099 2:72882269-72882291 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
932790365 2:74649639-74649661 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
933581321 2:84129982-84130004 ACTCCAAGTCAGAATGTGGGTGG - Intergenic
933685831 2:85140481-85140503 CCTCCATGGTGGAAGCTGGAGGG + Intronic
933732340 2:85466798-85466820 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
934777382 2:96948177-96948199 CCCCCATGCCAGGAGGTGGACGG - Intronic
935436776 2:103044206-103044228 ATAACATGGCAAAAGGTGGAAGG + Intergenic
935807751 2:106765785-106765807 ATCTCATGGTAGAAGGTGGAAGG + Intergenic
936800164 2:116256971-116256993 CCATCATGGCAGAAGGTGAAGGG + Intergenic
936800415 2:116258878-116258900 ACATCATGGCAGAAAGTGAAAGG + Intergenic
937649319 2:124302476-124302498 ATCCCATGGCAGAATGTGAAGGG + Intronic
937757391 2:125556820-125556842 AAATCATGGCAGAAGGTGAAGGG - Intergenic
938730635 2:134144295-134144317 CCATCATGGCAGAAGGTGAAGGG + Intronic
939015178 2:136894675-136894697 TCTACGTGTCAGAAGGTGGAGGG - Intronic
939209032 2:139147568-139147590 ACCACGTGGCGGAAGGTGGAAGG - Intergenic
939226962 2:139376865-139376887 AAATCATGGCAGAAGGTGAAGGG + Intergenic
939433164 2:142137365-142137387 ATTCCATGGCAGAAGGACCAGGG - Intergenic
940041186 2:149362664-149362686 ATCCCATGGCAGAAGGTAGAAGG + Intronic
940174731 2:150865455-150865477 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
940487069 2:154309510-154309532 AACTCATGGCAGAAGGTGGAAGG + Intronic
940488753 2:154329864-154329886 CAACCATGGCAGAAGGTGAAAGG - Intronic
940515844 2:154683094-154683116 CTCCCATGGCAGATGGTGGATGG - Intergenic
941567365 2:167126107-167126129 ACACCCTGGCAGAAGCTGCAAGG + Intronic
941888256 2:170551962-170551984 AAATCATGGCAGAAGGGGGAAGG - Intronic
941944163 2:171076368-171076390 ACCCCGTGGTAGAAGATGGAAGG - Intronic
942211948 2:173680017-173680039 ACCCCATGGCAGAAGGTAGAAGG - Intergenic
942970198 2:181949429-181949451 CATTCATGGCAGAAGGTGAATGG + Intergenic
943257408 2:185613388-185613410 ATATCATGGCAGAAGGTGAAAGG + Intergenic
943512127 2:188839352-188839374 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
943539377 2:189193027-189193049 ATCCCATGGCAGAAGGTAGAAGG - Intergenic
944024433 2:195146198-195146220 AAACCATGGCTGAAGGTGAAGGG - Intergenic
944038265 2:195324161-195324183 AACTCATGGCAGAAAGTGGAAGG - Intergenic
944082241 2:195801051-195801073 ACAGCATGGCAGAAGGTCGAAGG - Intronic
944480668 2:200154331-200154353 ACTCCAGGACAGTAGGAGGAGGG + Intergenic
944518700 2:200541014-200541036 ATCCCATGATAGAAGGTGGAAGG + Intronic
945084274 2:206115449-206115471 CTCCCATGGCAGAAGATGGAAGG - Intronic
945145282 2:206731928-206731950 TATTCATGGCAGAAGGTGAAGGG + Intergenic
945386003 2:209202004-209202026 GCACCATGGCAGAAGGTAGATGG + Intergenic
946002103 2:216491034-216491056 ACTGCAGAGCAGTAGGTGGAAGG - Intergenic
946132376 2:217616751-217616773 ATCCCATGGTGGAAGGTGGAGGG + Intronic
947008299 2:225537435-225537457 ACACCATGGCAGAAGGTGAAAGG + Intronic
947133484 2:226953969-226953991 AAGCCATGGCAGGAGGAGGATGG - Intronic
947264855 2:228267199-228267221 TCATCATGGCAGAAGGTGAAGGG + Intergenic
947769516 2:232659850-232659872 CAACCATGGCAGAAGGTGAAGGG + Intronic
948029680 2:234806989-234807011 ATCCCATGGCAGAATGTGGAAGG - Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
949019072 2:241730855-241730877 ACATCATGGCAGAAGGCGGAGGG + Intergenic
1168901095 20:1365668-1365690 ACCCCATGGTGGAGGGTGGAAGG + Intronic
1168957456 20:1844421-1844443 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1169624745 20:7552669-7552691 CCCACATGGCAGAAGATGGAAGG + Intergenic
1169846226 20:9994905-9994927 ATTCCTTGGCAGAAGGTAGAAGG + Intronic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1170819775 20:19747037-19747059 ATCACATGGCAGAAGGTGGAAGG + Intergenic
1170838108 20:19902334-19902356 ACTCCATGGAAGGTGGTGGGAGG - Intronic
1170838753 20:19907059-19907081 ATTCCATGGTGGAAGGTGGAAGG + Intronic
1170990279 20:21295094-21295116 ATTCCCTGGAAGAAGCTGGATGG - Intergenic
1171093561 20:22309686-22309708 ACTCCATAGCAGATGAGGGAGGG - Intergenic
1171247489 20:23623944-23623966 TGACCATGGCAGAAGGTGAAGGG + Intergenic
1171424087 20:25038842-25038864 ACGACATGGCAGATGGTGGTAGG - Intronic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1172080807 20:32339113-32339135 ACTCCATGGCTCAAGTTAGAGGG + Intergenic
1172818021 20:37705030-37705052 ACTTCATTGGAGAATGTGGATGG + Intronic
1173089325 20:39955310-39955332 CCTCCATGGCAGAAGGGCTAGGG + Intergenic
1173491754 20:43488277-43488299 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1174445111 20:50585762-50585784 ACTGCATGGCAGGAGGTGAGTGG - Intergenic
1174665868 20:52257150-52257172 ACTCTATGGCAGGTGGTGGCAGG + Intergenic
1174767477 20:53267541-53267563 AGTCCATGGCAGAGAGAGGATGG + Intronic
1175126499 20:56756109-56756131 ATTCCATGGTGGAAGGTGGAAGG + Intergenic
1175188316 20:57194871-57194893 ACTCATTGGCAGATGGTGCAGGG - Intronic
1175809025 20:61847507-61847529 ACGGCATGGCAGGAGGTGGTGGG - Intronic
1175880205 20:62253646-62253668 ATCTCATGGCAGAAGGTGGAAGG + Intronic
1176917128 21:14639362-14639384 ACTCCATGGCAGAAAGCAAAAGG + Intronic
1177079238 21:16617738-16617760 ATCCCGTGGCAGAAGGTGGAAGG + Intergenic
1177470309 21:21552703-21552725 TAACCATGGCAGAAGGTGAAGGG - Intergenic
1177575576 21:22950689-22950711 ATCCCATGGCAGGAGGTGGAAGG + Intergenic
1177693607 21:24542077-24542099 TTCACATGGCAGAAGGTGGAAGG + Intergenic
1178058900 21:28830399-28830421 CCGTCATGGCAGAAGGTGAAGGG - Intergenic
1178214865 21:30583874-30583896 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1178462128 21:32811925-32811947 ATTCCATGGTGGAAGGTGAAAGG - Intronic
1178608743 21:34061506-34061528 ATCCCATGGCAAAAAGTGGAAGG - Intergenic
1178922169 21:36745869-36745891 AACCCCAGGCAGAAGGTGGAAGG + Intronic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179033908 21:37743613-37743635 ATTTCATGACAGAAGGTGGAAGG - Intronic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1179158105 21:38868458-38868480 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1179158114 21:38868546-38868568 ACAACATGGCTGAAGCTGGAGGG + Intergenic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1181144606 22:20835750-20835772 AAAGCATGGCAGAAGGTGGCCGG + Intronic
1181975710 22:26727896-26727918 TTCACATGGCAGAAGGTGGAAGG + Intergenic
1182041347 22:27241087-27241109 ATCCCACGGCAGAAGGTGGACGG + Intergenic
1182054413 22:27338662-27338684 ATTCCATGGTAGAAGGTGGAAGG - Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1183063793 22:35350283-35350305 ACACTAGGGCAGGAGGTGGAGGG - Intergenic
1183957903 22:41393256-41393278 ACTCCAGCCCAGAAGGTCGAGGG + Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
1184764813 22:46566543-46566565 ACCCCATGGAAGAAGGCAGAAGG + Intergenic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
949210896 3:1499776-1499798 ATCCCATGGCAGAAGGAGGAAGG + Intergenic
949400446 3:3660086-3660108 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
949524918 3:4894007-4894029 ACTCGATGGTGGAGGGTGGAAGG + Intergenic
949636258 3:5984648-5984670 ATCACATGGCAGAAGGTGAAAGG + Intergenic
949965883 3:9355867-9355889 ACCCCACGGCAGAAGGCAGAAGG + Intronic
950117876 3:10463193-10463215 ACCCCAAGGCAGTGGGTGGAGGG - Intronic
950157509 3:10734112-10734134 ATTCCATGGGAGAAGGCAGAAGG - Intergenic
950455026 3:13087817-13087839 CTCCCGTGGCAGAAGGTGGAAGG + Intergenic
951085477 3:18508009-18508031 ACTGCATGGAAGAAAGTTGAGGG + Intergenic
951138001 3:19126730-19126752 ACTTCATGGTGGAAGGTGAAGGG + Intergenic
951237406 3:20251732-20251754 CCACCATGGTAGAAGGTGAAAGG + Intergenic
951256362 3:20453976-20453998 ATTCCATGGCAGAAGGCAGAAGG - Intergenic
951393383 3:22134771-22134793 ATACCATGGCAGAAGGTAGAAGG + Intronic
951809576 3:26684603-26684625 ACCACATGGCAGAAGGCAGAAGG + Intronic
952273994 3:31859600-31859622 ATCCCATGGCAGAAAGTGAAAGG - Intronic
952363974 3:32658768-32658790 ACTCCAGGTCAGAAGGAGGCTGG - Intergenic
952508315 3:34028223-34028245 ACTACATGGTAGTAGGTGGGTGG - Intergenic
952810705 3:37399988-37400010 ATTACATGGCAGAAGGTGAGAGG + Intronic
953000635 3:38929837-38929859 ATCCCATGGCAGAAGGCAGAAGG - Intronic
953144367 3:40260852-40260874 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
953402793 3:42640993-42641015 ACTCCAAGGCAGAGGTGGGAAGG - Intronic
953766184 3:45745710-45745732 TCATCATGGCAGAAGGTGAAGGG - Intergenic
953771987 3:45784850-45784872 ATCCCATGGCAGGAGGTGGGAGG + Intronic
953973155 3:47362641-47362663 CCATCATGGCAGAAGGTGAAAGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956234889 3:67058706-67058728 TCTTCATGGCAGAAGGTGAAAGG + Intergenic
956334803 3:68151556-68151578 ATACCATGGTGGAAGGTGGAAGG + Intronic
956401919 3:68888701-68888723 ATCCCATGGCAAAAGATGGAAGG + Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956545777 3:70400463-70400485 AACTCATGGCAGAAAGTGGAAGG - Intergenic
956758008 3:72408945-72408967 AGTTCATGGCAGAAAATGGAAGG - Intronic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
958030724 3:88105966-88105988 ATTACATGGCAGAAGGTAAAAGG - Intronic
958636214 3:96750427-96750449 ATTCCTGGGCAGAAGGGGGAGGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959433856 3:106288294-106288316 ACTCCATTGTGGAAGGTGAAAGG - Intergenic
959633833 3:108538895-108538917 ACCCCATGGCAGAGAGTGGAAGG + Intergenic
959808337 3:110586615-110586637 ATCCCATGGCAGAAGGTAAAAGG + Intergenic
960849831 3:122041377-122041399 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
960861312 3:122156723-122156745 CAACCATGGCAGAAGGTGAAGGG - Intergenic
961067091 3:123884570-123884592 ACTCCGAGGCAGAAGGCGGGTGG - Intergenic
962004080 3:131330875-131330897 ATCCCATGGCAGAAGTCGGAAGG + Intronic
962043392 3:131731117-131731139 ACTGCATGGCAGGAGGATGAAGG - Intronic
962201453 3:133403958-133403980 ACACCATGGCAGAATCAGGAAGG + Intronic
962252876 3:133848601-133848623 ATCCCATGTCAGAAGGTGGAAGG + Intronic
963553946 3:146761651-146761673 ATTCCATGGCAGAAGTTGAAAGG + Intergenic
963682705 3:148400192-148400214 ACAACATGGCAGAAGGTTAAAGG + Intergenic
964810598 3:160659717-160659739 ACTTCATGGCAGAAGGTAGAAGG - Intergenic
965183380 3:165433619-165433641 AATCCATGGCACAAGGTGAAGGG - Intergenic
965810812 3:172590108-172590130 AAACCATGGCAGAAGGTAAAGGG - Intergenic
966338704 3:178901267-178901289 ATCCCATGGCAGAAGGTGGATGG - Intergenic
966393236 3:179475026-179475048 ATCCAATGGCAGGAGGTGGAAGG + Intergenic
966627950 3:182039054-182039076 AGCCCGTGGCAGAGGGTGGAAGG - Intergenic
966978151 3:185104804-185104826 ACTGCATACCAGAAGGTGGAGGG + Intronic
967261663 3:187648782-187648804 AATCCATGGCAGAAGGCAAAGGG + Intergenic
967275919 3:187774413-187774435 ACTCCATGTCAGAAGTTAAAAGG - Intergenic
967380516 3:188852621-188852643 ATTCCAGGGCAGAAGGCAGAAGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968446353 4:654213-654235 ACTCCAGGGCAGGAGAGGGAGGG + Intronic
968818774 4:2835013-2835035 ACTCCATGGCAGAAAGTAAGGGG - Exonic
969905321 4:10388394-10388416 CAACCATGGCAGAAGGTGAAGGG + Intergenic
969920555 4:10535348-10535370 ACTCAATGGCCAAAGGTGCAGGG - Intronic
970083199 4:12314079-12314101 ACTTCAGGGTAGAAAGTGGAAGG + Intergenic
970351009 4:15201757-15201779 AAATCATGGCAGAAGGTGAAGGG - Intergenic
970459168 4:16255725-16255747 AAATCATGGCAGAAGGTGAAGGG + Intergenic
970459366 4:16257370-16257392 AAATCATGGCAGAAGGTGAAGGG + Intergenic
970475259 4:16415647-16415669 CAACCATGGCAGAAGGTGAAGGG - Intergenic
970505298 4:16723322-16723344 ATCCCATGGCGGAAGATGGAAGG + Intronic
970704285 4:18782076-18782098 CAACCATGGCAGAAGGTGAAGGG + Intergenic
970721447 4:18994027-18994049 ATTCTATGGCAGAAGATGAAAGG - Intergenic
971042617 4:22771121-22771143 AAATCATGGCAGAAGGTGAAAGG - Intergenic
971194131 4:24455770-24455792 ATTTCATGGCAGAAGGTAGAAGG - Intergenic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971365017 4:25970618-25970640 ACTCCCTGGCTGAGTGTGGATGG - Intergenic
971435395 4:26617174-26617196 ATCCCATGGCAGAAGGTGAGAGG + Intronic
971784301 4:31080981-31081003 GATCCATGGCAGAAAGTGAAAGG - Intronic
971892500 4:32543424-32543446 AAATCATGGCAGAAGGTGAAAGG - Intergenic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
971984705 4:33806995-33807017 ATCCCATGGCAGAAGGTGAAAGG - Intergenic
972036402 4:34527942-34527964 ATTCCATGGTGGAAGATGGAAGG + Intergenic
972268464 4:37485456-37485478 ATTCCATGGGGGAAGGTGGAAGG - Intronic
972296649 4:37745646-37745668 CCATCATGGCAGAAGGTGAAGGG + Intergenic
972395883 4:38659613-38659635 CTTGCATGGCAGAAGGTGAAGGG + Intergenic
973044942 4:45524415-45524437 ACTCTATTGCCGAAGCTGGAGGG - Intergenic
973612152 4:52645959-52645981 AAATCATGGCAGAAGGTGTAGGG - Intronic
973628067 4:52792426-52792448 AGCTCATGGCAGAAGGTGGAAGG + Intergenic
973765735 4:54160410-54160432 ATTTCATGACAGAAGGTGAAAGG - Intronic
974014288 4:56634784-56634806 ACTCCAGGGGACAAAGTGGATGG - Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974382487 4:61159382-61159404 ATCCCATGGCAGACGGTGGAAGG + Intergenic
974425038 4:61731628-61731650 TCTCCAAGGCAGAAGTGGGAAGG - Intronic
974438766 4:61890482-61890504 ATCCCATGGCAGAAGGCAGAAGG + Intronic
974642081 4:64644248-64644270 ACTTCAGGGTAGAGGGTGGAAGG - Intergenic
974796337 4:66755808-66755830 ATCCCATGGCAGAAGGTGAAAGG - Intergenic
974846215 4:67353513-67353535 CTCCCATAGCAGAAGGTGGAAGG + Intergenic
975231232 4:71935887-71935909 ATCCCATGGCAGAAGACGGAAGG - Intergenic
975351323 4:73350614-73350636 CATTCATGGCAGAAGGTGAAGGG + Intergenic
976128151 4:81855360-81855382 AAATCATGGCAGAAGGTGAAAGG + Intronic
976143094 4:82013433-82013455 ATCACATGGCAAAAGGTGGAAGG - Intronic
976270403 4:83224721-83224743 ACCCCATGGCAGAGGGTGGAAGG - Intergenic
976563105 4:86524120-86524142 ACTTCATGGTGGAAGGTGAAGGG - Intronic
976833668 4:89345796-89345818 TCGTCATGGCAGAAGGTGAAGGG - Intergenic
977112939 4:92983296-92983318 ATTACATGGCTGAAGGTGAAAGG + Intronic
977197697 4:94082936-94082958 TCATCATGGCAGAAGGTGAAAGG + Intergenic
977421417 4:96804755-96804777 ATTCCATGGTAGAAGGTAGAAGG - Intergenic
977706780 4:100080435-100080457 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
977772642 4:100878123-100878145 CATTCATGGCAGAAGGTGAAGGG + Intronic
978180140 4:105784311-105784333 ATCCCATGGCAGAATGTGGAAGG + Intronic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
978524560 4:109652556-109652578 ATCCCATGGCAGAAGGTGAAAGG + Intronic
978920160 4:114174465-114174487 CAACCATGGCAGAAGGTGAAAGG + Intergenic
979078530 4:116304627-116304649 CCATCATGGCAGAAGGTGAAAGG - Intergenic
979142382 4:117193455-117193477 AGTCCATGGCAGGAGTTGGCAGG + Intergenic
979435750 4:120687824-120687846 ATTCCATAGCGGAAGGTGAAAGG - Intronic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
980214525 4:129834645-129834667 AAATCATGGCAGAAGGTGAAAGG + Intergenic
980613872 4:135193817-135193839 TATTCATGGCAGAAGGTGAAGGG - Intergenic
981356734 4:143798234-143798256 CGTTCATGGCAGAAGGTGAAGGG + Intergenic
981516355 4:145613847-145613869 ATTCCATGGCAGAAAACGGAAGG - Intergenic
981530022 4:145743357-145743379 ATCCCATGGCAGAAGGTGGGAGG + Intronic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
981796756 4:148604470-148604492 ATCCCATGACAGAAGGAGGAAGG - Intergenic
981796993 4:148606547-148606569 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
981918456 4:150060504-150060526 ATCCCATGGCAGAAGATAGATGG + Intergenic
982034339 4:151330988-151331010 AAATCATGGCAGAAGGTGAAGGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
982627766 4:157788964-157788986 ATCCCACGGCAGAAGGTGGAAGG + Intergenic
982775889 4:159440962-159440984 AACTCATGGCAGAAGGTAGAAGG - Intergenic
982778017 4:159461880-159461902 ACTCCATGACAGATAGTGCAGGG - Intergenic
983489060 4:168367411-168367433 CCATCATGGCAGAAGGTGAAAGG - Intronic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
983630174 4:169842017-169842039 ACTCCTTGGCAGCAGCAGGATGG + Intergenic
983652026 4:170045076-170045098 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
983671223 4:170240131-170240153 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
983927644 4:173418869-173418891 CAACCATGGCAGAAGGTGAAGGG - Intergenic
984595897 4:181667620-181667642 ATGCCATGGTAGAAGGTGAAAGG - Intergenic
985073092 4:186187680-186187702 ATCCCATGGCAGAAGGTGAAAGG - Intergenic
985527252 5:412752-412774 ACTCCATTGCATAGGCTGGAGGG + Intronic
985786020 5:1895321-1895343 CCATCATGGCAGAAGGTGAAAGG - Intergenic
986104843 5:4649937-4649959 TCTGCATGGCAGATGGTGCAGGG - Intergenic
986469337 5:8058780-8058802 ATTCCATGGGCAAAGGTGGAGGG - Intergenic
986860480 5:11921348-11921370 CCATCATGGCAGAAGGTGAAAGG - Intergenic
987262629 5:16219159-16219181 AACTCATGGCAGAAGGTGAAGGG - Intergenic
987900134 5:24000286-24000308 ATCCCATGGAATAAGGTGGATGG - Intronic
987909273 5:24121410-24121432 AAATCATGGCAGAAGGTGAAGGG + Intronic
988096223 5:26614171-26614193 ATTCCATGGAAAAATGTGGAAGG - Intergenic
988257251 5:28836541-28836563 ACCCCATGGCAGAAGGCAGAAGG + Intergenic
989166394 5:38437161-38437183 ATTGCAGGGCAGAAGGTGCAAGG + Intronic
990832616 5:59976502-59976524 TATTCATGGCAGAAGGTGAAGGG - Intronic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
991484845 5:67124189-67124211 ACCCAAGGGTAGAAGGTGGAGGG - Intronic
991719447 5:69481729-69481751 AGTCCATGGCAGGAGGTGAGAGG + Intergenic
992223177 5:74592726-74592748 ACAACATGGCAGAAGGGTGATGG + Intergenic
992346207 5:75880965-75880987 AATTCATGGCAGAAGGTGAAGGG + Intergenic
992531996 5:77660838-77660860 GCCTCATGGCAGAAGGTGAAGGG - Intergenic
992934232 5:81685128-81685150 AAATCATGGCAGAAGGTGAAGGG - Intronic
992986738 5:82238162-82238184 ACTCCCTGCTATAAGGTGGAGGG - Intronic
993591155 5:89796658-89796680 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
993645169 5:90452989-90453011 ACCTCATGGTGGAAGGTGGAAGG + Intergenic
993698460 5:91090700-91090722 AATCCATGTCAGAAGGTAGTCGG + Intronic
993744915 5:91585540-91585562 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
994247155 5:97490707-97490729 ATCCCATGCTAGAAGGTGGAAGG - Intergenic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
994579849 5:101627887-101627909 AAATCATGGCTGAAGGTGGAGGG + Intergenic
994958949 5:106572928-106572950 ACCACATGGCAGAAGGCAGAAGG - Intergenic
995514091 5:112937113-112937135 CCCACATGGCAGAAGGTGGGAGG - Intergenic
995562555 5:113398675-113398697 ACTACATGGGAGAGGGAGGAAGG + Intronic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996509058 5:124298745-124298767 CAACCATGGCAGAAGGTGAAGGG + Intergenic
996662549 5:126021305-126021327 AAATCATGGCAGAAGGTGAAGGG - Intergenic
997211272 5:132078427-132078449 ACTCACTGACACAAGGTGGAGGG + Intergenic
997709894 5:135995475-135995497 TTTGCATGGCAGAAGGCGGAAGG - Intergenic
998133773 5:139664175-139664197 ACTCCAGGGAGGAGGGTGGATGG + Intronic
998487552 5:142516331-142516353 CATTCATGGCAGAAGGTGAAGGG - Intergenic
998656196 5:144182236-144182258 CATCCATGCCAGAAGGTGAAGGG - Intronic
998882940 5:146662505-146662527 ACCCCATGGCAGAAGCAGAAGGG - Intronic
999127754 5:149259014-149259036 AATCCAGGGCAGAAGGAGGAGGG - Exonic
999312729 5:150562230-150562252 TCTGCATGGCAGCAGATGGAGGG + Intergenic
1000955273 5:167535636-167535658 TTTACATGGCAGAATGTGGAAGG - Intronic
1001356289 5:171026890-171026912 ACTACATGGCAGGAGGTGAGCGG + Intronic
1001927166 5:175646336-175646358 ACCCCATGGCAAAAGGTAGAAGG + Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1001947381 5:175791163-175791185 AATTCATGGCATAAAGTGGAAGG - Intergenic
1002525966 5:179816459-179816481 TTTCGATGGCAGCAGGTGGAGGG + Intronic
1002693711 5:181070328-181070350 AGTCCTTGGCGGAAGGGGGAAGG - Intergenic
1002865558 6:1119058-1119080 ATCTCATGGCAGAAGGTGGAAGG - Intergenic
1002997233 6:2298082-2298104 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1003038249 6:2663443-2663465 ACTCCATAGAAGAAGGTGAAGGG - Intergenic
1003263107 6:4541148-4541170 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1003385768 6:5666023-5666045 GCTCCATGGCAGGATCTGGAGGG + Intronic
1003757448 6:9137610-9137632 ATCCCATGGTAGGAGGTGGAAGG - Intergenic
1003953566 6:11141613-11141635 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1003986853 6:11444036-11444058 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1004296411 6:14415863-14415885 CCATCATGGCAGAAGGTGAAGGG - Intergenic
1004506675 6:16252539-16252561 ACTCCCTTAAAGAAGGTGGAGGG - Intronic
1004994962 6:21181474-21181496 ATCCAATGGCAGAAGGTAGAAGG - Intronic
1005043507 6:21620558-21620580 ATTCCAGGGCAGAAGGGGGTGGG - Intergenic
1005167208 6:22938423-22938445 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1005206218 6:23408258-23408280 AAACCATTGCAGAAGGTTGAGGG + Intergenic
1005256126 6:24005205-24005227 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1005671775 6:28113596-28113618 ATTCTATGGCAGAAGGTGGAGGG - Intergenic
1006401801 6:33822068-33822090 ATCCCATGGCCAAAGGTGGAAGG - Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1006834536 6:36989470-36989492 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1006843053 6:37043292-37043314 ATCCCATGGCAGAAAGTGGAAGG + Intergenic
1007233420 6:40369424-40369446 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1007238532 6:40408512-40408534 ACTCCAGAGCAGAAGTTGGCAGG + Intronic
1007354531 6:41303120-41303142 ATCCCATGGCAGAAAGAGGAAGG - Intergenic
1007702813 6:43774354-43774376 CACCCATGGCAGAAGGAGGAGGG + Exonic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1008567661 6:52785030-52785052 ACATCAAGGCAGAAGGTGGTGGG + Intergenic
1008571796 6:52823866-52823888 ACATCAAGGCAGAAGGTGGTGGG + Intergenic
1008588796 6:52972616-52972638 ACACCATGGCACAATGTGGCTGG + Intergenic
1008975528 6:57421017-57421039 ATTACAGGGCAGATGGTGGAAGG + Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1009344872 6:62600948-62600970 CCCTCATGGCAGAAGGTGAAGGG - Intergenic
1009583533 6:65567138-65567160 TTCTCATGGCAGAAGGTGGAAGG - Intronic
1009792255 6:68419059-68419081 ACATCATAGCAGAAGGTGAAGGG - Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1009923792 6:70096162-70096184 ACTCCAGCCCAGGAGGTGGAGGG - Intronic
1009982246 6:70740857-70740879 AAATCATGGCAGAAGGTGAAAGG + Intronic
1010012835 6:71069143-71069165 ATTCCATGGCAGAAGGCAGAAGG + Intergenic
1010074282 6:71782934-71782956 GATTCATGGCAGAAGGTGAAGGG + Intergenic
1010125009 6:72421439-72421461 AACTCATGGCAGAAAGTGGAAGG + Intergenic
1010514774 6:76760065-76760087 ATCCCATGGCAAAAGGTAGAAGG + Intergenic
1010776079 6:79887564-79887586 ACCCCAAGGTAAAAGGTGGAAGG - Intergenic
1010926493 6:81752124-81752146 ACTACATGGCGGAGGGTGAAGGG - Exonic
1011210603 6:84952237-84952259 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1011810715 6:91129144-91129166 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1011811638 6:91138859-91138881 ATCCTATGGCAGAAAGTGGATGG - Intergenic
1011883117 6:92057272-92057294 ATCCCATGGAAGAAGGTAGAAGG + Intergenic
1011984908 6:93431147-93431169 ATGCCATGGCAGAAGGCAGAAGG - Intergenic
1011996319 6:93593421-93593443 CGTCTATAGCAGAAGGTGGAAGG - Intergenic
1012074853 6:94670749-94670771 ACATCATGGCAGAAAGTGAAGGG - Intergenic
1012349759 6:98235744-98235766 CTTTCATGGCAGAAGGTGAAGGG + Intergenic
1012742409 6:103034931-103034953 TTCCCATGGCTGAAGGTGGAAGG + Intergenic
1013280736 6:108634564-108634586 AAGCCAAGGCAGAAGGGGGAAGG - Intronic
1013673395 6:112430129-112430151 ACTCCATTTCACAATGTGGAAGG + Intergenic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1013862269 6:114650071-114650093 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1014149884 6:118042577-118042599 ACTCCTTGGCAAGATGTGGAAGG - Intronic
1014482955 6:121961299-121961321 ATCCTATGGCAGAAGGTGGAAGG - Intergenic
1014762788 6:125376319-125376341 ACTCTAAGAAAGAAGGTGGAGGG + Intergenic
1014805671 6:125826874-125826896 ACCCCATGGTGGAAGGTGGGAGG + Intronic
1015256770 6:131186292-131186314 AATCCATGGCAGAAGGCACAGGG - Intronic
1015634676 6:135263750-135263772 ATCCCTTGGCTGAAGGTGGAGGG + Intergenic
1015733359 6:136371210-136371232 ACTCCTTGAGAGAAGGTTGAGGG - Intronic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016224885 6:141722969-141722991 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1016526741 6:145010195-145010217 CCTACATGGTGGAAGGTGGAAGG - Intergenic
1016563217 6:145420797-145420819 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
1016790017 6:148058626-148058648 ACTGAATGGCAAAAGCTGGAAGG - Intergenic
1016834578 6:148464586-148464608 AGTGGATGGCAGCAGGTGGAAGG - Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1017286850 6:152685843-152685865 TCAACATGGCAGAAGGTAGAAGG - Intergenic
1017561157 6:155629369-155629391 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1018043311 6:159944206-159944228 ACCCCATGGCAGAAAGTGGGAGG - Intergenic
1018593640 6:165454609-165454631 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1018829253 6:167429940-167429962 AATCCACAGCAGAAGATGGAAGG - Intergenic
1018974091 6:168551189-168551211 CCATCATGGCAGAAGGTGAAGGG - Intronic
1019163169 6:170082302-170082324 ACCCCACAGCAGAAGGTGGGAGG - Intergenic
1019945635 7:4326904-4326926 ATCCCATGGCTGAAGGTGAAAGG + Intergenic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1021795932 7:24254293-24254315 TCTCCATGGGAGAAGGGGGAAGG - Intergenic
1022889703 7:34683659-34683681 ATTCCATGGCAGAAAGTGAGAGG + Intronic
1023123789 7:36935263-36935285 CCATCATGGCAGAAGGTGAAAGG - Intronic
1023295927 7:38715162-38715184 AACTCATGGCAGAAAGTGGAAGG + Intergenic
1023672987 7:42599227-42599249 AGGCCATGGCAGAAGGTGAAAGG - Intergenic
1024324210 7:48096042-48096064 AAGCCATGGCAGGAGGAGGAAGG - Intronic
1024490692 7:49980556-49980578 CACCCATGGCAGAAGGTGAAAGG + Intronic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1024710873 7:52012997-52013019 ATCCCATGGCAGAAGGTGAATGG - Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1025988598 7:66477239-66477261 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1026219331 7:68378983-68379005 AACTCATGGCAGAAAGTGGAAGG - Intergenic
1026277342 7:68891657-68891679 AACCCATGGCAGAAGGTGAAGGG + Intergenic
1026691604 7:72554641-72554663 CATCCATGGCTGAAGGTAGAAGG + Intergenic
1027211571 7:76153252-76153274 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1027434063 7:78145614-78145636 ATCCCATGGCAAAAGGAGGAAGG - Intronic
1027566241 7:79798763-79798785 ATCCCATGACAGAAGGTGGAAGG + Intergenic
1027782622 7:82538420-82538442 ATTCCATGGCAGAAGACAGAGGG + Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028201650 7:87968883-87968905 AAATCATGGCAGAAGGTGAAGGG + Intronic
1028339725 7:89703819-89703841 GATCCAGGGCAGAAGGTGGTGGG + Intergenic
1029583231 7:101452245-101452267 AGCCCATGGCAGCAGGTGGCAGG + Intronic
1029952584 7:104602832-104602854 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030040445 7:105445333-105445355 ATCCCATGGCAGAAGGTGGGAGG + Intronic
1030734481 7:113030277-113030299 ATAACATGGCAGAAGGTGAAAGG + Intergenic
1030897496 7:115079021-115079043 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
1031443881 7:121827066-121827088 CATCCATGGCAGAAGGTGAGAGG - Intergenic
1031567958 7:123322617-123322639 AAATCATGGCAGAAGGTGAAAGG - Intergenic
1031581971 7:123487177-123487199 ACTTCGTGGCAGAAGGTGAAGGG - Intronic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032273787 7:130436795-130436817 AGGCCAAGGCAGCAGGTGGATGG + Intronic
1033440169 7:141371369-141371391 CCACTATGGCAGAAGGTGAAGGG - Intronic
1033616821 7:143024322-143024344 ATCCTATGGCAGAAGGTGGAAGG - Intergenic
1033639898 7:143252285-143252307 AAATCATGGCAGAAGGTGAAGGG - Intronic
1033975654 7:147097458-147097480 CCATCATGGCGGAAGGTGGAGGG + Intronic
1034027365 7:147720741-147720763 TCATCATGGCAGAAGGTGAAAGG - Intronic
1034106821 7:148497388-148497410 ATTTCATGGAAGAAGGTGAAGGG - Intergenic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1034872723 7:154697790-154697812 ACGCCATGGCTGAAGGTGGTGGG - Intronic
1035109716 7:156470971-156470993 TCATCATGGCAGAAGGTGAAGGG - Intergenic
1035191575 7:157173763-157173785 ACTACATGTCAGATGGTGAAGGG + Intronic
1035262208 7:157669226-157669248 ACTCCGTGGCAGAAGAAGGGAGG - Intronic
1035340421 7:158157213-158157235 GAGCCATGGCAGAAGGTGGTGGG + Intronic
1035469777 7:159102350-159102372 AAATCATGGCAGAAGGTGCAAGG - Intronic
1035716419 8:1758674-1758696 ACTCCATGGATGCAGGTGGAAGG + Intronic
1036737828 8:11334052-11334074 ATCCCATGGCAAAAGGTGGAAGG - Intergenic
1037215284 8:16443765-16443787 ATCCCATGGCAGAAGGCAGAAGG - Intronic
1037269382 8:17109654-17109676 ACTACATGGCTAAGGGTGGAAGG + Intronic
1037508866 8:19561651-19561673 AGTACATGGCAGAAGGGGCAGGG + Intronic
1037744796 8:21634211-21634233 ATCCCATGGTAGAAGGTAGAAGG - Intergenic
1038090987 8:24252762-24252784 TCCCCATGGCAGAAGGTGGAAGG + Intergenic
1038402082 8:27291800-27291822 ATCCCATGGCAGAAGGAAGAAGG + Intronic
1038922463 8:32099907-32099929 ACTCAGTGGATGAAGGTGGAGGG + Intronic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1038936664 8:32259440-32259462 ATCCCATGGCAGAAGGTGGAAGG - Intronic
1039367046 8:36939787-36939809 ACTCCCAGGCAGAAGTAGGAGGG + Intergenic
1040441731 8:47450260-47450282 TTCCCATGGCAGAAGGTGAAAGG + Intronic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1040739731 8:50558231-50558253 GCTCCATGGCAGCAGCTGCATGG + Intronic
1040939019 8:52813771-52813793 ACTCCATAACAGAAGGGGAAGGG - Intergenic
1041223162 8:55671690-55671712 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1041317880 8:56582917-56582939 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1042076521 8:65001295-65001317 ATTTCATGGCAGAAGATGGAAGG + Intergenic
1042405199 8:68396806-68396828 CCCTCATGGCAGAAGGTGAAGGG - Intronic
1042586980 8:70350987-70351009 GTGCCATGGCAGCAGGTGGAAGG + Intronic
1042704388 8:71650906-71650928 ACCCCATGGCACCAGGTGCAGGG - Intergenic
1042851142 8:73217165-73217187 CCCACATGGCTGAAGGTGGAAGG - Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1043697573 8:83240072-83240094 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
1044565930 8:93661203-93661225 TATTCATGGCAGAAGGTGAAGGG - Intergenic
1044737821 8:95297235-95297257 CAACCATGGCAGAAGGAGGAAGG + Intergenic
1044760403 8:95511622-95511644 ACCTCATGGCAGAAGGCAGAAGG - Intergenic
1044895268 8:96885176-96885198 ATCCCATGGCAGAAGGTGGAAGG + Intronic
1044947010 8:97398723-97398745 ATACCATGGCAAAAGGTGGAAGG + Intergenic
1045998776 8:108395218-108395240 CTTACATGGCAGAAGGTGAAGGG + Intronic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1047141594 8:122146954-122146976 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1047425558 8:124742392-124742414 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1047874505 8:129120974-129120996 ATCCCATAGCAGAAGGTGGAAGG - Intergenic
1047990065 8:130276921-130276943 ACTCAATGGCAGACGATGGAAGG + Intronic
1048099735 8:131337500-131337522 AATTCATGCTAGAAGGTGGAAGG - Intergenic
1048666679 8:136669875-136669897 ACTGCATGGTGGAAGATGGAAGG - Intergenic
1050383519 9:5058318-5058340 AAATCATGGCAGAAGGTGAAGGG + Intronic
1050605391 9:7295931-7295953 AATACATGGTGGAAGGTGGAAGG - Intergenic
1050807771 9:9703217-9703239 AAATCATGGCAGAAGGTGAAAGG - Intronic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1051312857 9:15795153-15795175 ATCCCATGGCAGAAGGCAGAAGG + Intronic
1051375731 9:16400539-16400561 CCCCCATGGCTGAAGGTGGAAGG + Intergenic
1051613411 9:18983233-18983255 AAATCATGGCAGAAGGTGAAGGG + Intronic
1051624546 9:19086297-19086319 ACTCCATCTCAAAAGGGGGAGGG + Intronic
1052225550 9:26080926-26080948 ACTCCAGGGGCTAAGGTGGAAGG + Intergenic
1052648931 9:31274262-31274284 ATCCCATGGCAGAAGGTAAAAGG - Intergenic
1052997563 9:34559376-34559398 ACTCCAGGGCACCAGGTGGAGGG + Intronic
1053034385 9:34811490-34811512 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1053386076 9:37690847-37690869 ATCCCATGGAAGAAGGTGGAAGG + Intronic
1053458816 9:38252643-38252665 ACTCCCTGGAAGAAGGAGTAGGG - Intergenic
1053918364 9:42962843-42962865 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1055402830 9:75942588-75942610 GCACGGTGGCAGAAGGTGGAGGG + Intronic
1055840111 9:80493526-80493548 ATCCCAGGGCAGAAGGTGGAAGG + Intergenic
1056661877 9:88549750-88549772 CAACCATGGCAGAAGGTGAAAGG + Intronic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1056986083 9:91364561-91364583 ACTCCTGGGCAGAAGGGGGTGGG + Intergenic
1057041614 9:91852459-91852481 ACTCCATCCCAGATGGTGGAGGG + Intronic
1057316602 9:93972982-93973004 GAATCATGGCAGAAGGTGGAAGG + Intergenic
1057498462 9:95578400-95578422 ACTCCATGGCCATTGGTGGAGGG - Intergenic
1057642115 9:96834591-96834613 AACTCATGGCAGAAAGTGGAAGG - Intronic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1058322905 9:103656926-103656948 AGATCATGGCAGAAGGTGAAGGG - Intergenic
1059162176 9:112045243-112045265 ACTTGATGTCAGAAGTTGGAAGG - Intronic
1059370740 9:113831533-113831555 ATCCCATGGCAGAAGGCAGAAGG - Intergenic
1059825686 9:118026263-118026285 ATTCCATGGCAGAAGGTAGATGG + Intergenic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1060332007 9:122681336-122681358 ACCTCATGGTATAAGGTGGAAGG + Intergenic
1060746433 9:126136341-126136363 ATCCCATGGCAGAAGGTGGAAGG + Intergenic
1061379738 9:130247281-130247303 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1185775650 X:2800940-2800962 ACTCCATGGCCCAGGCTGGAAGG - Intronic
1186715390 X:12245814-12245836 ACTCCATGGTGGAAGGCAGAAGG - Intronic
1187314695 X:18182307-18182329 AAGTCATGGCAGAAGGTGAAGGG - Intronic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1187550000 X:20293045-20293067 ATCCCATGGCAGAAGGTGGAAGG - Intergenic
1187566640 X:20456711-20456733 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1188967830 X:36577208-36577230 ATCCCATGGCAGAAGGCAGAAGG + Intergenic
1189116602 X:38349547-38349569 ATTCCATGGCAGAAGGTAAAGGG - Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1192101929 X:68273928-68273950 AAATCATGGCAGAAGGTGAAAGG + Intronic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1193725777 X:85037435-85037457 AAATCATGGCAGAAGGTGAAAGG - Intronic
1193843829 X:86443607-86443629 ACTCAATGGCAAAAAGTTGAAGG - Intronic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1193938612 X:87652939-87652961 AGGCCATGGCAGAAGGTGAAAGG + Intronic
1193984150 X:88219936-88219958 ACCACATGGTAGAAGGTGAAAGG + Intergenic
1194172947 X:90611236-90611258 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1194321270 X:92448535-92448557 TCTACATGGCAGGGGGTGGAGGG - Intronic
1194455004 X:94092753-94092775 ACTCTATGGCAGTAGTTGAAAGG - Intergenic
1194465184 X:94225801-94225823 ATTCCATAGCTAAAGGTGGAAGG - Intergenic
1194544274 X:95213253-95213275 ATTTCATGGCAGAATGTGGAAGG - Intergenic
1194560472 X:95412816-95412838 AAGTCATGGCAGAAGGTGAAAGG - Intergenic
1194618485 X:96137545-96137567 CAACCATGGCAGAAGGTGAAGGG - Intergenic
1194759257 X:97774928-97774950 ATCCTATGGCGGAAGGTGGAAGG - Intergenic
1194895719 X:99436805-99436827 ACTAGATGGCGGAAGGAGGAGGG - Intergenic
1195168018 X:102239359-102239381 ATCCAATGGCAGAAGGTGGGAGG + Intergenic
1195190839 X:102447728-102447750 ATCCAATGGCAGAAGGTGGGAGG - Intronic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195450613 X:105008152-105008174 ATCCTATAGCAGAAGGTGGAAGG + Intronic
1196076695 X:111585668-111585690 TATTCATGGCAGAAGGTGAATGG - Intergenic
1196319223 X:114268781-114268803 AAATCATGGCAGAAGGTGAAGGG + Intergenic
1196638367 X:118030748-118030770 ATCCCATGGCAGAAGTTGGAAGG - Intronic
1197108546 X:122744633-122744655 AAAACATGGCAGAAGGTGAAGGG + Intergenic
1197342510 X:125289723-125289745 ATCTCATGGCAGAAGGTGGGAGG - Intergenic
1197342809 X:125293604-125293626 ATCCCATGGTGGAAGGTGGAAGG + Intergenic
1197349143 X:125360605-125360627 ACTCCATGGCAGTAAGCAGAAGG - Intergenic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1198319028 X:135499979-135500001 ATCCCATGGTGGAAGGTGGAAGG - Intergenic
1198607277 X:138355788-138355810 GACCCATGGCAGAAGGTGAAGGG + Intergenic
1198742747 X:139858089-139858111 GCCCCATGGCAGAAGGTGGAAGG - Intronic
1198840032 X:140846621-140846643 ATCCCATGGCAGAATATGGAAGG + Intergenic
1198968513 X:142252949-142252971 ACACCATGGCAGAAGGCAAAGGG - Intergenic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1199549173 X:149039932-149039954 ACTCCATGGCAGAAGGCAGAAGG + Intergenic
1199569226 X:149251424-149251446 CAACCATGGCAGAAGGTGAAAGG + Intergenic
1199584121 X:149395208-149395230 ACTATATGGCAGAAGGTGAAGGG - Intergenic
1199779472 X:151044971-151044993 AAATCATGGCAGAAGGTGAAGGG - Intergenic
1200132114 X:153855921-153855943 GGTGCTTGGCAGAAGGTGGATGG - Intergenic
1200274755 X:154721401-154721423 ACCCCATAGCAGAAGGCAGAAGG + Intronic
1200332446 X:155311779-155311801 AAATCATGGCAGAAGGTGAAAGG + Intronic
1200382978 X:155859123-155859145 ATCCCATGGCAGAAGGTAGAAGG - Intergenic
1200553574 Y:4607401-4607423 ACGCCTTGCCAGAAGGTGGGGGG + Intergenic
1200629387 Y:5561682-5561704 TCTACATGGCAGGGGGTGGAGGG - Intronic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1201717280 Y:17059513-17059535 ACTACTTGGCAGAAGGGTGAAGG + Intergenic