ID: 1056956968

View in Genome Browser
Species Human (GRCh38)
Location 9:91090408-91090430
Sequence CTGGCTGATCATCCTTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056956968_1056956973 -5 Left 1056956968 9:91090408-91090430 CCATCACAAGGATGATCAGCCAG No data
Right 1056956973 9:91090426-91090448 GCCAGGACAGAGGGGTGACCTGG No data
1056956968_1056956976 4 Left 1056956968 9:91090408-91090430 CCATCACAAGGATGATCAGCCAG No data
Right 1056956976 9:91090435-91090457 GAGGGGTGACCTGGTGACCTGGG No data
1056956968_1056956975 3 Left 1056956968 9:91090408-91090430 CCATCACAAGGATGATCAGCCAG No data
Right 1056956975 9:91090434-91090456 AGAGGGGTGACCTGGTGACCTGG No data
1056956968_1056956980 21 Left 1056956968 9:91090408-91090430 CCATCACAAGGATGATCAGCCAG No data
Right 1056956980 9:91090452-91090474 CCTGGGTCATGGTACTCTGCAGG No data
1056956968_1056956977 10 Left 1056956968 9:91090408-91090430 CCATCACAAGGATGATCAGCCAG No data
Right 1056956977 9:91090441-91090463 TGACCTGGTGACCTGGGTCATGG No data
1056956968_1056956981 22 Left 1056956968 9:91090408-91090430 CCATCACAAGGATGATCAGCCAG No data
Right 1056956981 9:91090453-91090475 CTGGGTCATGGTACTCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056956968 Original CRISPR CTGGCTGATCATCCTTGTGA TGG (reversed) Intergenic
No off target data available for this crispr