ID: 1056964313

View in Genome Browser
Species Human (GRCh38)
Location 9:91153251-91153273
Sequence ATGTATCCACAGGAGCAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056964310_1056964313 1 Left 1056964310 9:91153227-91153249 CCAATCTTAGGTTCTACAATAGT 0: 106
1: 288
2: 345
3: 270
4: 272
Right 1056964313 9:91153251-91153273 ATGTATCCACAGGAGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056964313 Original CRISPR ATGTATCCACAGGAGCAATT GGG Intergenic
No off target data available for this crispr