ID: 1056965568

View in Genome Browser
Species Human (GRCh38)
Location 9:91160886-91160908
Sequence TCGCCCTCCCCAGTATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056965568_1056965571 -3 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965571 9:91160906-91160928 CGAGTCAGAGCAGGGCCCAGAGG No data
1056965568_1056965576 12 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965576 9:91160921-91160943 CCCAGAGGGGAGCAGCAGGCAGG No data
1056965568_1056965574 8 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965574 9:91160917-91160939 AGGGCCCAGAGGGGAGCAGCAGG No data
1056965568_1056965578 13 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965578 9:91160922-91160944 CCAGAGGGGAGCAGCAGGCAGGG No data
1056965568_1056965580 25 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965580 9:91160934-91160956 AGCAGGCAGGGCACAATTTCGGG No data
1056965568_1056965572 -2 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965572 9:91160907-91160929 GAGTCAGAGCAGGGCCCAGAGGG No data
1056965568_1056965573 -1 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965573 9:91160908-91160930 AGTCAGAGCAGGGCCCAGAGGGG No data
1056965568_1056965579 24 Left 1056965568 9:91160886-91160908 CCAGGGGATACTGGGGAGGGCGA No data
Right 1056965579 9:91160933-91160955 CAGCAGGCAGGGCACAATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056965568 Original CRISPR TCGCCCTCCCCAGTATCCCC TGG (reversed) Intergenic
No off target data available for this crispr