ID: 1056965948

View in Genome Browser
Species Human (GRCh38)
Location 9:91163013-91163035
Sequence GGGTCTCTGTGGCGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056965948_1056965957 30 Left 1056965948 9:91163013-91163035 CCTCCCTGTCGCCACAGAGACCC 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1056965957 9:91163066-91163088 TCAATCATCGCAGACTGTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056965948 Original CRISPR GGGTCTCTGTGGCGACAGGG AGG (reversed) Intergenic
900086457 1:900170-900192 GGGTGACTGTGGGGGCAGGGAGG - Intergenic
900126869 1:1072643-1072665 GGATCTCTGGGGCGAGAGAGGGG - Intronic
900127030 1:1073250-1073272 GGGGCTTTGGGACGACAGGGAGG + Intronic
900326482 1:2110857-2110879 TGGACTCTGTGGGGCCAGGGTGG + Intronic
901018334 1:6243981-6244003 GGGTCCCTCGGGAGACAGGGGGG + Intergenic
903657958 1:24960511-24960533 GGGGCTCTGGGGCGGCGGGGGGG - Intronic
903681517 1:25100671-25100693 GGCCCTGTGTGGGGACAGGGAGG - Intergenic
904301564 1:29557746-29557768 GGGTCGGGGTGGGGACAGGGTGG - Intergenic
904492526 1:30869897-30869919 GGGTCACTGTGGTGCCAGGCAGG + Intronic
904872468 1:33627438-33627460 GGGTCCCTGAGGCTGCAGGGGGG - Intronic
907126716 1:52056611-52056633 GGGTCTGGGCGGCAACAGGGCGG - Intronic
907920011 1:58903655-58903677 GAGTCTCAGTGGCGGCGGGGCGG + Intergenic
908405314 1:63808684-63808706 GGGTCTCTCTGGCTGCAAGGAGG + Intronic
910360455 1:86410323-86410345 GGGTCTGTGGGGACACAGGGTGG - Intergenic
910676359 1:89820842-89820864 GGGTCTGTGTGGCGAGGGAGGGG - Intronic
911364978 1:96927226-96927248 TGGCTTCTGTGGCGACAGTGAGG + Intergenic
912410739 1:109479317-109479339 GGGTCATTGTGGGAACAGGGAGG - Intronic
912962973 1:114212505-114212527 GTGTGTCTGTGCTGACAGGGGGG - Intergenic
914515617 1:148371657-148371679 GGGACTCTGTGGCCACCTGGTGG - Intergenic
914704026 1:150157023-150157045 GGCTCACTGTGGGGAGAGGGAGG + Intronic
915164562 1:153941389-153941411 GGGTCTCTGTGGGGAAGGGAAGG + Exonic
915363694 1:155301509-155301531 GGGATTCTGTGGGGACAGGGTGG - Intergenic
920457989 1:206115921-206115943 GGGTCTATGTGGGGGCAGTGAGG - Intronic
922701126 1:227761720-227761742 GGGTATGTGTGGCGTCAGGCAGG + Intronic
922792395 1:228317558-228317580 TGGTCTCTGTGGCTACCGCGTGG + Exonic
922811242 1:228416677-228416699 GGGACTTTGTGGCGTCAGCGGGG + Intronic
923608057 1:235463216-235463238 GGGACTTGGTGGGGACAGGGTGG + Intronic
924632276 1:245752313-245752335 GGGCCTCTGTGAGGGCAGGGAGG - Intronic
1065412030 10:25439888-25439910 GGGTCTCTAAGGCTACAGGAAGG + Intronic
1067577435 10:47417433-47417455 GGGGCTCTGTGGCAAATGGGTGG - Intergenic
1067577445 10:47417469-47417491 GGGGCTCTGTGGTGAATGGGTGG - Intergenic
1067577457 10:47417523-47417545 GGGGCTCTGTGGTGAATGGGTGG - Intergenic
1067577518 10:47417811-47417833 GGGGCTCTGTGGCAAATGGGTGG - Intergenic
1067577528 10:47417847-47417869 GGGGCTCTGTGGTGAATGGGTGG - Intergenic
1069242809 10:66163322-66163344 GGATCTCTGTGGTGCCAGGAAGG + Intronic
1070020153 10:72577172-72577194 GGGGCTCTGGGGGGACAGGTGGG + Intronic
1071515427 10:86293678-86293700 GTGTCTCTGTGCTGACAGGTTGG - Intronic
1074410069 10:113220568-113220590 GGGTCAATGTGGATACAGGGCGG + Intergenic
1074536703 10:114333112-114333134 GGGTCTGTGTGCCGGCTGGGAGG + Intronic
1075702370 10:124477894-124477916 GGGTCTCGGAGGCCACAGAGGGG - Intronic
1075823778 10:125336387-125336409 GGGTCTCTGTGGCTGCAGGCTGG - Intergenic
1076251107 10:128984478-128984500 GGGGCTCTGTGGGCACAGGCAGG - Intergenic
1076640695 10:131914784-131914806 GGGTGCCTGTGGGGAAAGGGTGG + Intronic
1076831470 10:132996507-132996529 GGGTCTCCGTGGGGTCAGGGTGG - Intergenic
1076831477 10:132996528-132996550 GGGTCTTCGTGGGGTCAGGGTGG - Intergenic
1076831490 10:132996563-132996585 GGGTCTCCGTGGGGTCAGGGTGG - Intergenic
1076831498 10:132996584-132996606 GGGTCTCCGTGGGGTCAGGAAGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1078598617 11:12711485-12711507 GGGTCTCTGAGGCTCCAGGGAGG - Intronic
1078897226 11:15607377-15607399 GGGTATCTGAGGAGCCAGGGAGG + Intergenic
1080686842 11:34523075-34523097 GGGTGTCTGTGGGGAGAGTGTGG - Intergenic
1083768022 11:64851448-64851470 GGCTCTGTGTGGCCACAGAGGGG - Intergenic
1084033198 11:66492965-66492987 GGGTGTGTGTGTGGACAGGGAGG - Intronic
1084171348 11:67402296-67402318 GGGTCTCTGTGGCGCCCAGGCGG + Intronic
1085026546 11:73239857-73239879 GGCTCTGTGTGGCGGCAGTGGGG - Intergenic
1085408253 11:76276845-76276867 GGGTCTCTGGGTAGGCAGGGGGG + Intergenic
1085479442 11:76809207-76809229 CGGGCTCTGTGGGGATAGGGAGG - Intergenic
1085926214 11:81025291-81025313 TGGTCTCTGTGACAACAGGAGGG + Intergenic
1086042865 11:82499934-82499956 AGGAATCTGTGGTGACAGGGAGG + Intergenic
1087053081 11:93905627-93905649 GGCCCTCTGTGGGGAAAGGGAGG - Intergenic
1087166438 11:95009061-95009083 GGGTTACTGTGGCCACAGTGGGG - Intergenic
1087608069 11:100401467-100401489 GGGTCTCTGTGGCTATTTGGTGG + Intergenic
1089643912 11:119865505-119865527 TGGTCTCTGTGGCCTCAGGTGGG + Intergenic
1090382774 11:126338530-126338552 AGCTCTCTGTGGGGACTGGGTGG + Intronic
1090836974 11:130461100-130461122 GGCTCGCTGAGGCAACAGGGAGG - Intronic
1091461255 12:644934-644956 TGTTCTCTGTGGCTACAGTGAGG + Intronic
1093824930 12:23672434-23672456 GGGGCCCTTTGGTGACAGGGAGG - Intronic
1096842130 12:54385878-54385900 GGGAATCTGAGGCGACAGGGAGG + Intronic
1097295398 12:57957763-57957785 GGATCTCTGTGGTGACAGGCAGG - Intergenic
1098911456 12:76213476-76213498 GGGTTTTTGGGGCGGCAGGGTGG - Intergenic
1099777500 12:87151783-87151805 GGGTCCCTGTGGTGTCAGGCAGG + Intergenic
1101311552 12:103585228-103585250 AGGTCTCTGTGGCCACTGGCAGG + Intergenic
1103053781 12:117802721-117802743 GGGTATCTGTGGGGAAAAGGGGG - Intronic
1103888757 12:124222745-124222767 GGGACTCTGAGCTGACAGGGTGG - Intronic
1104619325 12:130299136-130299158 AGGTCACTGTGGTGACATGGTGG - Intergenic
1105354226 13:19643865-19643887 AGGTCTCTGTGGTGACACTGTGG - Intronic
1105405360 13:20128325-20128347 GAATCTCTGTGTAGACAGGGTGG + Intergenic
1105730581 13:23211483-23211505 TGGTCTCTATGGTGAAAGGGGGG - Intronic
1107282733 13:38755334-38755356 GGGTTCCTGGGGCCACAGGGAGG - Intronic
1108373909 13:49795861-49795883 GGGTCTCGGGGGAGACAGGAAGG + Intergenic
1110132368 13:72023223-72023245 GGGTCTGTGGGGACACAGGGTGG + Intergenic
1111611591 13:90614424-90614446 GGGTCTATGGGGACACAGGGTGG - Intergenic
1113231109 13:108215235-108215257 GGGTCTGTGGGGCGTCAGAGGGG - Intronic
1115299157 14:31865175-31865197 GGATCTCTGTGGTGACAGGCAGG - Intergenic
1116526330 14:45910404-45910426 GGGTATCTGTGGGCACAGGATGG - Intergenic
1119897271 14:78230798-78230820 GGGTCTCAAAGGCCACAGGGAGG + Intergenic
1120800102 14:88678276-88678298 GGGCCTCTTGGGGGACAGGGAGG + Intronic
1120921946 14:89763423-89763445 GGGCCTGTGTGGGGACAGTGGGG - Intergenic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1123579609 15:21704243-21704265 GGGTCCACGTGGGGACAGGGGGG - Intergenic
1123616236 15:22146754-22146776 GGGTCCACGTGGGGACAGGGGGG - Intergenic
1123782949 15:23645303-23645325 GGGTCTCTGAGGCAGCAGAGGGG + Exonic
1127382309 15:58440610-58440632 GGGTGTGTGTGGGGGCAGGGAGG + Intronic
1129242360 15:74259188-74259210 AGGTCTTTGGGGGGACAGGGAGG + Intronic
1130914279 15:88292278-88292300 GTGTCTCTCTGGCCACAAGGAGG - Intergenic
1202988479 15_KI270727v1_random:438488-438510 GGGTCCACGTGGGGACAGGGGGG - Intergenic
1132685785 16:1161547-1161569 GGGTCTCCATGGCCACAGGAGGG + Intronic
1133233661 16:4377965-4377987 GGGTCCATCTGGCCACAGGGTGG - Intronic
1133839633 16:9395684-9395706 GGGTCTCTTTGGCTCCAGAGGGG + Intergenic
1134845602 16:17437342-17437364 GGGTTTCTGTGGCCACATGTGGG - Intronic
1135033903 16:19060629-19060651 GGGACAGTGTGGCCACAGGGTGG + Intronic
1136463719 16:30428100-30428122 AGGTCACTGTGTCTACAGGGTGG - Intronic
1136707411 16:32201532-32201554 GGGTCTCGGCATCGACAGGGTGG + Intergenic
1136760501 16:32727885-32727907 GGGTCTCGGCATCGACAGGGTGG - Intergenic
1136807602 16:33142501-33142523 GGGTCTCGGCATCGACAGGGTGG + Intergenic
1138313673 16:56049985-56050007 GGGTATCTGTGGTCACATGGAGG + Intergenic
1141792594 16:86246736-86246758 GGGTCTCTGTGGCACTATGGGGG - Intergenic
1142157811 16:88540587-88540609 GGGGCTCTGAGGGGACAGAGGGG - Intergenic
1203062654 16_KI270728v1_random:988200-988222 GGGTCTCGGCATCGACAGGGTGG - Intergenic
1142766654 17:2068134-2068156 GGGCCTCTCTGGCTAGAGGGTGG + Intronic
1143476592 17:7206890-7206912 GGGACACTGTGGGGTCAGGGTGG - Intronic
1143515335 17:7416909-7416931 GGGTCCCTGTGGGCACAGGAGGG - Exonic
1144139769 17:12337004-12337026 GGATCTCTGTGGTGCCAGGCAGG + Intergenic
1148117690 17:45186740-45186762 GAGTCTCTCTGGCGCCAGGCTGG - Intergenic
1149659500 17:58326969-58326991 GGGTGTCTATGTGGACAGGGAGG - Intronic
1151653022 17:75481587-75481609 GGGTATGTGTGGAGACAGGCAGG + Intronic
1151853525 17:76706139-76706161 GGGCCTCTGTGACGGCAGTGTGG - Intronic
1151853529 17:76706160-76706182 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853541 17:76706223-76706245 GGGCCTCTGTGACGGCAGAGTGG - Intronic
1151853549 17:76706265-76706287 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853553 17:76706286-76706308 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853568 17:76706370-76706392 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853572 17:76706391-76706413 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1152088149 17:78232456-78232478 GGGGCTGTGGGGCGACAGTGGGG + Intronic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1154165916 18:12014356-12014378 GGGTCTCCGGGGAGACAGGTGGG + Exonic
1160049729 18:75421580-75421602 GGAGCTCTGTGGGGTCAGGGTGG + Intronic
1160585140 18:79909856-79909878 GGGACTCTGTGGTGAGATGGTGG - Intronic
1161818975 19:6517233-6517255 GGTCCTCTGTGGGTACAGGGTGG + Intergenic
1162750290 19:12825564-12825586 GGGTCTCTGGAGCTCCAGGGAGG + Exonic
1163241158 19:16064666-16064688 GGGTCTCTGGGGACACAGCGGGG + Intergenic
1163563971 19:18038656-18038678 GGGTCATTGTGAGGACAGGGTGG + Intergenic
1165108443 19:33487750-33487772 GTGTCCCAGTGGTGACAGGGTGG + Intronic
1165633002 19:37317516-37317538 GGGTCTCTGTGTTCACCGGGAGG + Intronic
1167181515 19:47907590-47907612 GGGACTGGGTGACGACAGGGGGG + Intergenic
1167182831 19:47918341-47918363 GGGACTGGGTGACGACAGGGGGG + Intergenic
1167183500 19:47923691-47923713 GGGACTGGGTGACGACAGGGGGG + Intergenic
1167184796 19:47934093-47934115 GGGACTGGGTGACGACAGGGGGG + Intergenic
1167186121 19:47944834-47944856 GGGACTGGGTGACGACAGGGGGG + Intergenic
1167266997 19:48488199-48488221 GGGCCTCTGTGAGGACAGGGTGG - Intronic
1167300113 19:48673139-48673161 GGGTCCCTGTGGGGATAGCGTGG - Intergenic
1167541752 19:50092675-50092697 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167542425 19:50098012-50098034 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167542862 19:50101077-50101099 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167543298 19:50104141-50104163 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167543732 19:50107200-50107222 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167544406 19:50112554-50112576 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167545081 19:50117906-50117928 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167545758 19:50123260-50123282 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167546435 19:50128588-50128610 GGGACTGGGTGACGACAGGGGGG - Intergenic
1167547763 19:50139303-50139325 GGGACTGGGTGACGACAGGGGGG - Intergenic
1168257499 19:55174781-55174803 GGGTTTCTTCGGGGACAGGGAGG - Intronic
1168571531 19:57475042-57475064 GAGTCTCTGTGGCAACAGCTAGG + Exonic
1168584571 19:57582574-57582596 GGTTTCCTGTGGTGACAGGGTGG + Intronic
926313044 2:11688288-11688310 GGGTGACTGTGGGGAGAGGGAGG - Intronic
926813188 2:16774625-16774647 GAGTCTCTGTGGAGCCAGGAAGG + Intergenic
927418156 2:22901574-22901596 CGGTCTCTGTGCCGACAGCTTGG - Intergenic
931881898 2:66577269-66577291 GGGTCTCAGTGGGGAGATGGGGG + Intergenic
933531438 2:83517305-83517327 GGATCTCTGTGGTGCCAGGAAGG - Intergenic
935319440 2:101871639-101871661 GGGTGTCTGTGGGGACATGGTGG - Intronic
937911619 2:127078308-127078330 GGGTCTCTGTCCTGACATGGGGG + Intronic
938300642 2:130208979-130209001 GGGTCTGTGTAGAGACAGGAGGG + Intergenic
938456083 2:131465492-131465514 GGGTCTGTGTAGAGACAGGAGGG - Intronic
939932684 2:148254634-148254656 GGGTCTGTGAGGACACAGGGTGG - Intronic
943621236 2:190150329-190150351 GGATCTCTGTGGTGCCAGGCAGG + Intronic
947457163 2:230265554-230265576 GGGTCCCTGTGGTGCCAGGCAGG + Intronic
948158802 2:235807354-235807376 GTGTATCTCCGGCGACAGGGAGG - Intronic
948211477 2:236196431-236196453 GGGTCTCAGTGGGGAAAGGGTGG + Intronic
948544384 2:238716731-238716753 AGGTCTCTGTGGTGACGGCGTGG + Intergenic
948797300 2:240411648-240411670 GGGCCTCTTGGGCCACAGGGTGG - Intergenic
1170771505 20:19336761-19336783 GGCTCTCTGTGCCAACAGGAAGG - Intronic
1171371736 20:24666770-24666792 GGGTCTCTGTGTCCACTGAGGGG - Intergenic
1172115374 20:32570513-32570535 GGGTGACTGTGGGGACAGGAGGG - Intronic
1172799289 20:37564875-37564897 GGGTCTCTGAGGGGACTGAGAGG - Intergenic
1174414807 20:50359701-50359723 GGGGCCCTGTGGCCACAGAGAGG + Intergenic
1175150110 20:56927061-56927083 GGGTCACTGTAGGGAAAGGGGGG + Intergenic
1175368398 20:58470818-58470840 GGCTCTCTGTGGCCACAGTGGGG - Intronic
1175862905 20:62159684-62159706 GGGTCTCGGTGGGGACGGGAGGG - Intronic
1176063922 20:63184470-63184492 GGGCCTCTGTGGCCAGAGGAGGG - Intergenic
1177506174 21:22020390-22020412 GTCTCTCTGTGGCGATATGGAGG + Intergenic
1178059286 21:28834531-28834553 GGATCCCTGTGGTGACAGGCAGG - Intergenic
1178801595 21:35800947-35800969 GGATCTCTGTGGTGCCAGGCAGG - Intronic
1179053165 21:37906658-37906680 GGGTCTCTGTGGACAAAAGGAGG - Intronic
1181069134 22:20321473-20321495 GTGTCTGTGTGGAGACTGGGAGG + Intergenic
1181815876 22:25436501-25436523 GAGTCTCTGGGGCAAGAGGGAGG + Intergenic
1182115303 22:27753062-27753084 GTGTCTCTGGGGCTCCAGGGTGG - Intronic
1182453296 22:30433760-30433782 GGGTCTCTGTTCCTACGGGGTGG - Intergenic
1183691601 22:39392771-39392793 GGGGCTGTGTGGGGACAGTGGGG - Intergenic
1184767736 22:46580341-46580363 GGGTCTCTTTGGCACCACGGTGG + Intronic
1184815042 22:46862715-46862737 GCTTCTCTATGGCTACAGGGAGG - Intronic
1185339257 22:50284287-50284309 GGGACCCGGTGGCCACAGGGAGG - Intronic
950148429 3:10668017-10668039 GGCGCTCAGTGGCCACAGGGTGG + Intronic
951508282 3:23473586-23473608 GGGACTCAGTGGGGAAAGGGTGG - Intronic
953717196 3:45325859-45325881 GGGTCCCTGTGGCCACAGGAGGG - Intergenic
953844751 3:46418551-46418573 GGGTCTGTGGGGACACAGGGTGG - Intergenic
953926787 3:46986667-46986689 GGGTCTCTGTGGGGCCACTGAGG + Intronic
954469031 3:50675480-50675502 GGGTCTCTGTGCAGAGAGGGCGG + Intronic
959279699 3:104323008-104323030 GGCTCTCTGTGGTGCCAGGCAGG - Intergenic
960710778 3:120525885-120525907 GGGTCTCTGTGAGGGCAGGTGGG - Intergenic
961436422 3:126921576-126921598 GGCTCTCTGTGGGACCAGGGAGG - Intronic
963644425 3:147895888-147895910 GGGTCCCTTTGGCCACAAGGAGG + Intergenic
965463437 3:168997771-168997793 GGTTCTATGTGGGGATAGGGAGG - Intergenic
966039325 3:175461929-175461951 GGGTTTCTGGGGAGAGAGGGAGG + Intronic
966861518 3:184233380-184233402 GGGGCTCTGTGACGACAGGTTGG + Exonic
967257605 3:187609444-187609466 GGATCTCTGTGGTGCCAGGCAGG + Intergenic
968522271 4:1039410-1039432 GGTTCTCTGTGGCACCTGGGGGG + Intergenic
968657193 4:1783706-1783728 AGGCCTCTGTGGGGCCAGGGAGG + Intergenic
972006546 4:34115316-34115338 GTGTCTGTGTAGAGACAGGGAGG - Intergenic
972746033 4:41933777-41933799 AGTTCTCTCTGGCAACAGGGTGG - Intergenic
977575004 4:98665909-98665931 GGGTCTGTGGGGACACAGGGTGG - Intergenic
978016788 4:103754292-103754314 GGGTCTCTGAGGACACAGGGTGG + Intergenic
980129987 4:128809648-128809670 GGGTCACTGCTGCCACAGGGGGG - Exonic
985531012 5:433888-433910 GGGCCTCTGGAGTGACAGGGCGG + Exonic
985882226 5:2646771-2646793 GGATCTGTGTGGGAACAGGGTGG - Intergenic
991098504 5:62765199-62765221 GGGTCTCTGTGACTACCTGGGGG + Intergenic
992796500 5:80258589-80258611 GGGCTTCTGTGGGGACAGTGGGG - Intergenic
996885961 5:128353989-128354011 GGGTCAGTGGGGAGACAGGGAGG - Intronic
998149875 5:139750767-139750789 GGGTGTCTGGGGCAAGAGGGAGG + Intergenic
998732821 5:145100331-145100353 GTGTCTGTGTGGTGACAGTGTGG + Intergenic
1001045153 5:168365721-168365743 GTGTCGCTGTGGAGACAGGTAGG - Intronic
1001196854 5:169680796-169680818 GGTTATCTGTGGGGACAGGTAGG - Intronic
1002526013 5:179816681-179816703 GGCTCTCAGTGGCGCCTGGGGGG - Intronic
1003450794 6:6229971-6229993 GGATCTCTGTGGTGCCAGGCAGG - Intronic
1004899736 6:20183078-20183100 AGTTCTCTGTGGCTACAGGTTGG - Intronic
1006105708 6:31715191-31715213 GGGCCCCAGTGGGGACAGGGAGG - Intronic
1013254184 6:108367649-108367671 GGGTTTCTGTGGTGACAAGGGGG + Intronic
1014738687 6:125123982-125124004 GGGTCCCTGTGGTGCCAGGCAGG - Intronic
1016283559 6:142447832-142447854 CCGTCTCTGTGGCCACAGGCAGG - Intergenic
1018115031 6:160574513-160574535 GGATCTCTGTGGTGCCAGGCAGG + Intronic
1018938784 6:168294027-168294049 GGTGCTCTGTGGGGACGGGGAGG - Intronic
1019352230 7:559685-559707 GGCTCGCTGTGGAGTCAGGGAGG + Intronic
1020014074 7:4820873-4820895 GGCTCTCCGTGGTGAGAGGGAGG - Intronic
1021183789 7:17539026-17539048 GGGACTCGGTGGGGAAAGGGTGG + Intergenic
1022048608 7:26643634-26643656 TGGTCTCAGTGGCGGCGGGGGGG + Intronic
1023879867 7:44312279-44312301 AGGTGTCAGTGGCGAGAGGGTGG + Intronic
1023888498 7:44376880-44376902 GGGACACTGAGGGGACAGGGAGG - Intergenic
1024000284 7:45185048-45185070 GTGACTGTGTGGAGACAGGGAGG + Intronic
1024563665 7:50664464-50664486 GTGTGTCTGTGGGGGCAGGGGGG + Intronic
1024655573 7:51448725-51448747 AGCTCTCTGTGGCTACAGCGTGG - Intergenic
1026689100 7:72536930-72536952 GGGTCACTCTGGCTGCAGGGAGG + Intergenic
1030325125 7:108211264-108211286 GGATCTCTGTGGTGCCAGGCAGG - Intronic
1030976140 7:116125966-116125988 GGGCCTCTGTGGTATCAGGGTGG - Intronic
1033708438 7:143911974-143911996 GGGTCTATGTGGCTATAGAGAGG - Intergenic
1034420870 7:150989961-150989983 AGCACTCTGTGGCCACAGGGAGG - Intergenic
1037878454 8:22561060-22561082 GGGTGTGTGTGGGAACAGGGAGG + Intronic
1039819656 8:41124596-41124618 AGGTCTGTGTGGCCACAGGTGGG - Intergenic
1040106349 8:43544448-43544470 AGGTCTCTGTGGGGGCAGGCTGG + Intergenic
1049183895 8:141238681-141238703 AGGTCTCTGTGGGGAATGGGTGG - Intronic
1051355464 9:16236011-16236033 GGGGCTCTCTGGCCACAGTGTGG - Intronic
1053231733 9:36416164-36416186 GGCTTGCTGTGGCCACAGGGCGG + Intronic
1053415179 9:37942907-37942929 GGATCACTGGGGGGACAGGGAGG + Intronic
1053577216 9:39364870-39364892 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1053841716 9:42192795-42192817 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1054098787 9:60923560-60923582 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1054120187 9:61199189-61199211 AGGTCTCTGTGGAGAGTGGGAGG - Intergenic
1054587569 9:66983373-66983395 AGGTCTCTGTGGAGAGTGGGAGG + Intergenic
1054811045 9:69434188-69434210 GGGACTCTGTGCAGCCAGGGTGG + Intronic
1055306365 9:74933486-74933508 GAGTCTCTGTGTCGCCAGGCTGG - Intergenic
1055917126 9:81415946-81415968 TGGTCTCTCTGGTGGCAGGGAGG - Intergenic
1056322821 9:85452491-85452513 GGATCCCTGTGGTGCCAGGGAGG + Intergenic
1056770491 9:89474970-89474992 GGGTGCCTGGGGCTACAGGGAGG + Intronic
1056965948 9:91163013-91163035 GGGTCTCTGTGGCGACAGGGAGG - Intergenic
1057007469 9:91573258-91573280 AGGTCACTGTGGCTACTGGGTGG + Intronic
1060546983 9:124467677-124467699 GGGTCTGGGTGGTGCCAGGGGGG + Intronic
1060723083 9:125990953-125990975 TGGTCTCAGAGGGGACAGGGAGG - Intergenic
1061219589 9:129242549-129242571 GGATCTCTGAGGCTACTGGGAGG + Intergenic
1061252096 9:129432407-129432429 GGGTCTCTGTGGGGGCAGGATGG + Intergenic
1061678088 9:132229556-132229578 GAGGCTCTGTGGGGACAGGCGGG - Intronic
1061937878 9:133868229-133868251 GGGTCTGTGTGGCAACACGAGGG + Intronic
1062285863 9:135772222-135772244 GGGCCTCTGTGGGTACAGTGAGG - Intronic
1188045996 X:25426557-25426579 GGGTCCCTGTGGTGCCAGGCAGG + Intergenic
1189283964 X:39838958-39838980 GAGTCTCTCTTGCGTCAGGGGGG - Intergenic
1189328044 X:40125010-40125032 GGGTGTGTGTGGCGTCGGGGGGG + Intronic
1189794419 X:44633772-44633794 GGTTCCCTGGGACGACAGGGGGG + Intergenic
1192174367 X:68876680-68876702 GGGTCTAGGTGTTGACAGGGAGG + Intergenic
1192970341 X:76221782-76221804 GGATCTCTGTGGTGCCAGGCAGG + Intergenic
1195740574 X:108061033-108061055 AGGTCACTGTGGCTAAAGGGAGG + Intronic
1196561303 X:117152457-117152479 GGGTCTCTGTGAGGTGAGGGTGG - Intergenic
1197671740 X:129284838-129284860 GGGTCCCTGTGGTGCCAGGGAGG + Intergenic