ID: 1056966429

View in Genome Browser
Species Human (GRCh38)
Location 9:91166350-91166372
Sequence CAGGGTGGAGTCTCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056966429_1056966434 -4 Left 1056966429 9:91166350-91166372 CCAGCAACAGAGACTCCACCCTG No data
Right 1056966434 9:91166369-91166391 CCTGGTGTCAAATCTAACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056966429 Original CRISPR CAGGGTGGAGTCTCTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr