ID: 1056980854

View in Genome Browser
Species Human (GRCh38)
Location 9:91309957-91309979
Sequence CACTGGATGAGACACCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056980854_1056980862 29 Left 1056980854 9:91309957-91309979 CCCCCTAGGTGTCTCATCCAGTG No data
Right 1056980862 9:91310009-91310031 GATGACTCCCAAGTTCACCTGGG No data
1056980854_1056980861 28 Left 1056980854 9:91309957-91309979 CCCCCTAGGTGTCTCATCCAGTG No data
Right 1056980861 9:91310008-91310030 TGATGACTCCCAAGTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056980854 Original CRISPR CACTGGATGAGACACCTAGG GGG (reversed) Intronic