ID: 1056980854

View in Genome Browser
Species Human (GRCh38)
Location 9:91309957-91309979
Sequence CACTGGATGAGACACCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056980854_1056980861 28 Left 1056980854 9:91309957-91309979 CCCCCTAGGTGTCTCATCCAGTG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1056980861 9:91310008-91310030 TGATGACTCCCAAGTTCACCTGG No data
1056980854_1056980862 29 Left 1056980854 9:91309957-91309979 CCCCCTAGGTGTCTCATCCAGTG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1056980862 9:91310009-91310031 GATGACTCCCAAGTTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056980854 Original CRISPR CACTGGATGAGACACCTAGG GGG (reversed) Intronic
901335238 1:8443640-8443662 CATAGGATGAGAAACCTAAGAGG + Intronic
902630029 1:17699229-17699251 CTCTGGATGGGACTCCCAGGGGG + Intergenic
902834959 1:19041050-19041072 CCCTGGATGGGTCACCTATGTGG + Intergenic
903690100 1:25167351-25167373 CACAGGATGAGAGAAGTAGGTGG + Intergenic
910222869 1:84906253-84906275 CAATGTATGAGACTCCTAGTTGG - Intergenic
911667037 1:100565136-100565158 CACAGGCTGAGACGCCTAGGAGG + Intergenic
913403590 1:118462981-118463003 CACTGGATGAAACAGCTAAAAGG - Intergenic
915584342 1:156836131-156836153 CACAGGATGACACACCTGGGAGG + Intronic
921673789 1:217954953-217954975 AACTTGATTAGAAACCTAGGAGG - Intergenic
921769633 1:219021366-219021388 CAATGGAAGAGTCACCAAGGAGG + Intergenic
1065057474 10:21861564-21861586 CACAGGATGAGACAGGAAGGAGG + Intronic
1072280561 10:93861968-93861990 CACAGGCTGAGAGGCCTAGGAGG + Intergenic
1077390229 11:2297359-2297381 GCCTGGATGAGACACCTCTGTGG - Exonic
1077599990 11:3567950-3567972 CACAGGATGAGGCTCCTTGGTGG + Intergenic
1089725856 11:120479238-120479260 CAGAGGATGAGAGACCTAAGTGG + Intronic
1090274264 11:125408615-125408637 CTCTGGAGGAGACGCCAAGGGGG + Intronic
1090419322 11:126563171-126563193 CACTGGATGAAAGAGCTAGCAGG + Intronic
1091582303 12:1797228-1797250 CAGTGGAGGAGACACGCAGGAGG - Intronic
1095511106 12:42952714-42952736 CACAGGCTCAGAGACCTAGGAGG + Intergenic
1108154547 13:47572457-47572479 CACAGGCCCAGACACCTAGGAGG + Intergenic
1108663542 13:52607362-52607384 CTCTGGATCAGACACCTGAGAGG + Intergenic
1109631848 13:65059929-65059951 CACTGGATGAGAGATGTATGAGG + Intergenic
1110489561 13:76087230-76087252 CACAGGCTGAGAGGCCTAGGAGG - Intergenic
1117343570 14:54811777-54811799 CACTGGATGTGACACATAGCAGG - Intergenic
1117578209 14:57123231-57123253 CACTGGATGACACAGCAAGAAGG - Intergenic
1118837024 14:69484787-69484809 CACTGGACGCGGCACCAAGGGGG - Exonic
1122641144 14:103160424-103160446 CCCTGGAGGAGACCCCTTGGGGG - Intergenic
1124012385 15:25849209-25849231 CAGTGGATGAAACACAGAGGGGG + Intronic
1124717428 15:32077965-32077987 CACTGGAGGTGGCACCTAAGGGG - Intronic
1126982775 15:54264351-54264373 TACTGGATGGGACATCTAAGTGG + Exonic
1127134928 15:55910331-55910353 CACTGGATGTGTCAGTTAGGAGG - Intronic
1127631071 15:60828140-60828162 CACTTGAGGAGACAGCTATGAGG + Intronic
1127921740 15:63500124-63500146 CACAGTATCAGACACCTAGTTGG + Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1132860308 16:2067801-2067823 ATGTGGATGAGACACCAAGGAGG - Intronic
1138272220 16:55703429-55703451 CACTAGATGTGGCACCTTGGAGG + Intronic
1143098151 17:4489506-4489528 CACTGGCTGTGTGACCTAGGTGG + Intergenic
1144751845 17:17654083-17654105 CACAGGATCAGAGGCCTAGGAGG - Intergenic
1144835613 17:18155174-18155196 CACTGCACGAGACACCTGGGAGG + Exonic
1145910506 17:28539418-28539440 ACCTGGAGGTGACACCTAGGGGG - Intronic
1146423882 17:32717095-32717117 CACTGGATGAGCCACATAAAAGG + Intronic
1146938719 17:36828626-36828648 CTCTGGAAGAGACACCCAGAGGG + Intergenic
1147745262 17:42690971-42690993 AACTGGAGGAGACACCAATGGGG + Intronic
1149566852 17:57646374-57646396 CAGTGGATGAGACACTTTGCTGG - Intronic
1150849980 17:68695212-68695234 TTCTGGCTGAGACACCTGGGAGG + Intergenic
1150981010 17:70141613-70141635 CATGGGATGACACAACTAGGAGG - Intergenic
1151693353 17:75701021-75701043 CCCTGGAGGAGACAGCTTGGAGG + Intronic
1156971456 18:43162433-43162455 CCCTTGCTGAGACAGCTAGGTGG + Intergenic
1163158317 19:15450591-15450613 AAGTGGATGAGATAGCTAGGTGG - Intergenic
1163783661 19:19263273-19263295 CACTGGCTGTGAGACCTTGGAGG + Intergenic
1166805027 19:45481218-45481240 CACTGGCTGAGGCAACTGGGAGG + Intergenic
1167286467 19:48601288-48601310 CACTGGAGGAGGCCCCTGGGGGG - Exonic
1167468790 19:49664201-49664223 CACGGGATTAGACACCAAGTTGG - Intronic
933099073 2:78227532-78227554 CAGTGGTTGAGACAGGTAGGAGG + Intergenic
933404995 2:81846709-81846731 GACTGTGTGAGACACCCAGGAGG + Intergenic
935953137 2:108349252-108349274 TTGTGGATGAGAAACCTAGGTGG - Intergenic
936161767 2:110088853-110088875 CACAGGCTCAGAGACCTAGGAGG + Intronic
936182896 2:110282501-110282523 CACAGGCTCAGAGACCTAGGAGG - Intergenic
936658506 2:114516058-114516080 CACTGAATCAGAGACTTAGGAGG - Intronic
940467089 2:154044868-154044890 CACAGGATGAGATATCTAGAGGG + Intronic
940928166 2:159392104-159392126 CACTGTATGACACACCTGTGTGG + Intronic
940978857 2:159978644-159978666 CACTACATGAGACAGCTGGGTGG - Intronic
946805001 2:223463176-223463198 CACAGGCTAAGAAACCTAGGAGG + Intergenic
1175227759 20:57454816-57454838 TCCTGGATGTGACACCGAGGAGG + Intergenic
1180011454 21:45054084-45054106 TACTGAATGCCACACCTAGGAGG + Intergenic
1182128902 22:27836376-27836398 CACGGGTTGAGACAATTAGGGGG - Intergenic
1184296456 22:43528208-43528230 GACTGGAGGAGACACCTGGCAGG + Intergenic
1184706204 22:46215197-46215219 CACAGGATAAGTCACCGAGGAGG - Exonic
950919918 3:16684035-16684057 CAAGGGAAGAGACACATAGGAGG - Intergenic
951281624 3:20757322-20757344 CTCTGGATCAGAAACCTTGGAGG - Intergenic
951319054 3:21223007-21223029 CACTTGATCAAAAACCTAGGTGG + Intergenic
951612324 3:24504263-24504285 CACTGAATCAGAAACCTTGGGGG + Intergenic
955166319 3:56517825-56517847 CACTGGATGGCACACTTATGTGG - Intergenic
955412614 3:58665577-58665599 CACTGGATGAATCATCTAGAAGG + Intronic
955417750 3:58708510-58708532 CACTGGATGTGACCCATAGTAGG - Intergenic
956287745 3:67628412-67628434 GAGTGGATGAGACACCCAGAGGG + Intronic
957070815 3:75566612-75566634 CACAGGATGAGGCTCCTTGGTGG + Intergenic
959897372 3:111619942-111619964 AACTGGATGTGAGAGCTAGGTGG - Intronic
961374866 3:126457423-126457445 CACTGGCTGAGGCACCTGGAGGG + Intronic
962431762 3:135326642-135326664 CACTGGCTGACACACCCTGGGGG - Intergenic
963319009 3:143792482-143792504 CACTGGATTTGACCCCTAGGAGG - Intronic
964723662 3:159792332-159792354 CACAGGGTGAGACTCTTAGGCGG - Intronic
968205476 3:196795844-196795866 CACTGGATGTGGCACCTCCGTGG + Intronic
969739538 4:9014144-9014166 CACAGGATGAGGCTCCTTGGTGG - Intergenic
970349530 4:15188083-15188105 CACAGGCTCAGAGACCTAGGAGG - Intergenic
972046872 4:34676688-34676710 CTCTGATTGAGACACCTAGTGGG + Intergenic
972129074 4:35807668-35807690 CACTGAAAATGACACCTAGGAGG + Intergenic
972289381 4:37677417-37677439 CAATGAATGAGACTCTTAGGAGG - Intronic
976530841 4:86150493-86150515 CAATGGATTAGCCACTTAGGAGG + Intronic
985617044 5:929329-929351 CACAGGCTCAGAGACCTAGGAGG + Intergenic
985949889 5:3215100-3215122 CAGTGGATGAGGCACCTGGGAGG + Intergenic
987910009 5:24129674-24129696 TTCTGGATGAGACACTTAAGTGG + Intronic
988169871 5:27639582-27639604 CACTGAAAGAGACACTGAGGAGG - Intergenic
993763566 5:91827544-91827566 CACTGGATGAGGAACCTCTGTGG - Intergenic
1001824493 5:174734469-174734491 CAGTGTCTGAGACTCCTAGGGGG + Intergenic
1002132469 5:177089988-177090010 CACTGGGTGTGTGACCTAGGAGG + Intronic
1005876239 6:30011831-30011853 CAATGGAGGAGACATCTATGAGG + Intergenic
1006419169 6:33922878-33922900 CTCTGAATGAGACAGCTTGGTGG + Intergenic
1008564055 6:52749980-52750002 CACTGTAAGAGACAACAAGGTGG + Intergenic
1009271594 6:61621593-61621615 CATTGGATGGGACATCTGGGTGG + Intergenic
1011197914 6:84801276-84801298 TACTGGATGGGACACCTGGATGG - Intergenic
1016085661 6:139911230-139911252 CACTGGATGACACAGCAAGGAGG - Intergenic
1016839308 6:148509972-148509994 CACTGAATGAGGAACCTATGGGG - Intronic
1017895426 6:158675246-158675268 CACTGGATGTGACAGAGAGGGGG + Intronic
1018922746 6:168186690-168186712 CACAGGCTGGGAGACCTAGGAGG - Intergenic
1022837284 7:34130384-34130406 AACTGGAGTAGACAGCTAGGAGG - Intronic
1023884939 7:44348014-44348036 CCCTGGAGGAGACACCAGGGAGG - Intergenic
1024330220 7:48147773-48147795 CCCTGTGTGAGACACCCAGGGGG - Intergenic
1027268170 7:76505250-76505272 GAGTGGATGAGTCACCTGGGAGG + Intronic
1027556450 7:79670151-79670173 CACAGGCTGAGAGGCCTAGGAGG + Intergenic
1029509602 7:100985734-100985756 CTCTGGACGAGACACAGAGGAGG + Intronic
1030270888 7:107667147-107667169 CACAGGGTGAGACATCTAAGTGG + Intronic
1036244587 8:7105365-7105387 CACAGGATGAAACTCCTTGGTGG - Intergenic
1036251887 8:7169329-7169351 CACTTAAGGAGAGACCTAGGGGG - Intergenic
1036365604 8:8118132-8118154 CACTTAAGGAGAGACCTAGGGGG + Intergenic
1037425344 8:18749468-18749490 CAAGGGATGAGACTCTTAGGGGG - Intronic
1039680436 8:39730059-39730081 CACTGGAGGAGGCACATGGGAGG - Exonic
1043275249 8:78384960-78384982 CACAGGCTCAGAGACCTAGGAGG + Intergenic
1045970246 8:108071940-108071962 CCCTGGATGAGACACCTTGCTGG - Intronic
1056980854 9:91309957-91309979 CACTGGATGAGACACCTAGGGGG - Intronic
1058253908 9:102736971-102736993 CAATGGAAAAGAAACCTAGGGGG - Intergenic
1059449691 9:114362599-114362621 CAGTGGATGAGACAGCTTGCGGG + Intronic
1060150114 9:121283019-121283041 CACTGGATTGGACATCGAGGAGG - Intronic
1061219550 9:129242387-129242409 CAGTGGATGGGACTCCCAGGAGG - Intergenic
1061416072 9:130447571-130447593 CCCCGGAAGAGACACCTGGGAGG - Intronic
1061857454 9:133449958-133449980 CACCGGCTGACTCACCTAGGTGG - Exonic
1187382455 X:18816594-18816616 TAATGGATGAAACAACTAGGTGG - Intronic
1188890179 X:35601635-35601657 CACTGGATAACACAGCAAGGAGG - Intergenic
1192583411 X:72302723-72302745 CACTGGGTAATGCACCTAGGAGG + Intronic
1194469276 X:94272559-94272581 CACAGGCTCAGAGACCTAGGAGG + Intergenic
1198521786 X:137460514-137460536 AACTGGATGTGACAGCTAGGGGG + Intergenic
1200245130 X:154519469-154519491 CCCTGAATGAGCCACCTACGTGG + Intergenic
1200859767 Y:7978156-7978178 CACTGAATGCAAAACCTAGGTGG - Intergenic
1201318862 Y:12675700-12675722 CACAGAATGAGACACTTAAGAGG - Intergenic
1202071785 Y:20999456-20999478 CACTGAATATGACACCTAGAAGG - Intergenic
1202174506 Y:22085110-22085132 CCCTGTATGAGACACCCATGGGG + Intronic
1202216854 Y:22501272-22501294 CCCTGTATGAGACACCCATGGGG - Intronic
1202326333 Y:23694798-23694820 CCCTGTATGAGACACCCATGGGG + Intergenic
1202544439 Y:25975256-25975278 CCCTGTATGAGACACCCATGGGG - Intergenic