ID: 1056983658

View in Genome Browser
Species Human (GRCh38)
Location 9:91341193-91341215
Sequence CATTGTGGGCAGTGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 404}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056983658_1056983671 17 Left 1056983658 9:91341193-91341215 CCAGCCTCCCACTGCCCACAATG 0: 1
1: 0
2: 5
3: 38
4: 404
Right 1056983671 9:91341233-91341255 CTGGGCAGCCTTGGAGAAAGGGG No data
1056983658_1056983670 16 Left 1056983658 9:91341193-91341215 CCAGCCTCCCACTGCCCACAATG 0: 1
1: 0
2: 5
3: 38
4: 404
Right 1056983670 9:91341232-91341254 ACTGGGCAGCCTTGGAGAAAGGG No data
1056983658_1056983665 -1 Left 1056983658 9:91341193-91341215 CCAGCCTCCCACTGCCCACAATG 0: 1
1: 0
2: 5
3: 38
4: 404
Right 1056983665 9:91341215-91341237 GCTCACCTCACCACATAACTGGG No data
1056983658_1056983667 8 Left 1056983658 9:91341193-91341215 CCAGCCTCCCACTGCCCACAATG 0: 1
1: 0
2: 5
3: 38
4: 404
Right 1056983667 9:91341224-91341246 ACCACATAACTGGGCAGCCTTGG No data
1056983658_1056983669 15 Left 1056983658 9:91341193-91341215 CCAGCCTCCCACTGCCCACAATG 0: 1
1: 0
2: 5
3: 38
4: 404
Right 1056983669 9:91341231-91341253 AACTGGGCAGCCTTGGAGAAAGG No data
1056983658_1056983664 -2 Left 1056983658 9:91341193-91341215 CCAGCCTCCCACTGCCCACAATG 0: 1
1: 0
2: 5
3: 38
4: 404
Right 1056983664 9:91341214-91341236 TGCTCACCTCACCACATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056983658 Original CRISPR CATTGTGGGCAGTGGGAGGC TGG (reversed) Intronic
900186827 1:1336707-1336729 TGGTGGGGGCAGTGGGAGGCAGG + Intronic
900274151 1:1812640-1812662 CAGTGAGGCCTGTGGGAGGCTGG - Intronic
900290355 1:1921118-1921140 CACTGTGGGCCCTGGGGGGCTGG + Intergenic
900329617 1:2127500-2127522 GGCTGAGGGCAGTGGGAGGCGGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900501024 1:3004701-3004723 TGTTGTGGGCCCTGGGAGGCAGG + Intergenic
900594793 1:3475856-3475878 CACTGTGGGCAGCCAGAGGCTGG + Intronic
900611343 1:3545820-3545842 GCTTGTGGCCAGCGGGAGGCTGG - Intronic
901071890 1:6524568-6524590 CATTATTGCCTGTGGGAGGCTGG - Exonic
901125808 1:6927980-6928002 GATTGTGGGAGGAGGGAGGCAGG - Intronic
901236201 1:7668985-7669007 CATTGGGGGGAGTGGGTGCCTGG - Intronic
901923578 1:12552523-12552545 CCTGGTGGGCAATGGGAGGGTGG - Intergenic
902041448 1:13495473-13495495 CATGGTGGGGAGGGGGAGGGAGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902604505 1:17561361-17561383 CAGTGGGGGCACTGGGAGGTGGG + Intronic
903344155 1:22673648-22673670 CACAGTGGGGGGTGGGAGGCTGG + Intergenic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903670411 1:25031992-25032014 TAGGATGGGCAGTGGGAGGCTGG + Intergenic
904929517 1:34075260-34075282 TCTTGTGGGCAGAAGGAGGCTGG - Intronic
905204501 1:36335513-36335535 AGTTGTGGACAGTTGGAGGCTGG - Intergenic
905312389 1:37058993-37059015 GACAGTGGGGAGTGGGAGGCAGG - Intergenic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
905873801 1:41419470-41419492 CAGTGGGGGCAGTGCCAGGCTGG - Intergenic
906394770 1:45452660-45452682 CATTTTGGACTTTGGGAGGCAGG + Intronic
906610933 1:47202003-47202025 CATTGTGGGGAGAGGGAGCATGG + Intergenic
908061962 1:60359964-60359986 CAAAGTGGGGAGTGGGAGCCAGG + Intergenic
909073478 1:71025053-71025075 CATTGTGGGGTGGGGGAGGGGGG - Intronic
909082268 1:71126828-71126850 CATTGTAGGCACTGTGAGTCGGG + Intergenic
910649987 1:89556275-89556297 ATTTGAGGGCAGTGGGAGGATGG - Intronic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911377580 1:97069744-97069766 CTTTGGGGGCAGTGGGGGGGGGG + Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
915341604 1:155179560-155179582 CATGGAGGGCAGGGGCAGGCAGG - Intronic
915463166 1:156081674-156081696 CTTTGGGGGCGGTGGGGGGCTGG + Exonic
915842443 1:159225456-159225478 CATTGCTTGAAGTGGGAGGCGGG + Intergenic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920430792 1:205917572-205917594 CTTTGTGGGCCGTTAGAGGCAGG + Intronic
920878960 1:209862797-209862819 CACTGCGGGCAGTGAGGGGCGGG - Intergenic
920881278 1:209882515-209882537 CATTGGGGTCAGTGGGTAGCAGG - Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
921332250 1:214050897-214050919 TATTGTGTGCATTGGGAGGGTGG - Intergenic
922173910 1:223179935-223179957 AAAAGTGTGCAGTGGGAGGCTGG - Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923328792 1:232903523-232903545 CATGATGGGCAGTGGGAGTCAGG - Intergenic
1062904717 10:1172048-1172070 CAGCGTGGGATGTGGGAGGCTGG - Intergenic
1063428129 10:5965519-5965541 CACTGCGGGCTGTGGGAGGGTGG - Intronic
1064031643 10:11886739-11886761 CACTGTGGGAACTGGGAGCCTGG + Intergenic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1066173804 10:32881729-32881751 AATTGTGGGGTGTGGGGGGCGGG - Intronic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1066381840 10:34908518-34908540 CAGAGTGGGCAGTGGTAGGTGGG - Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070624984 10:78044674-78044696 GACTGTGGGCACTGGGAGGCAGG - Intronic
1071292206 10:84195992-84196014 CTTTGTGGGTAGTGGGAACCCGG + Intronic
1071526089 10:86359384-86359406 CAGTGTGGCCAGTGAGGGGCAGG + Intronic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1072418932 10:95273208-95273230 CCCTGTGGGCACTGGGAGCCTGG - Intronic
1073598088 10:104819627-104819649 TGTGCTGGGCAGTGGGAGGCAGG + Intronic
1073680543 10:105698878-105698900 CAGGGAGGGGAGTGGGAGGCAGG - Intergenic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074270406 10:111947915-111947937 GAGTGTGGGGAGTGGGAGGAGGG + Intergenic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1075315934 10:121453628-121453650 GGTTGTGGGCAGTGTGAGGCAGG + Intergenic
1077218431 11:1404755-1404777 CTTAGTGGGCAGTGGGTAGCGGG - Intronic
1077294474 11:1819132-1819154 CATTGTGGGCATTTGGGGCCAGG - Intergenic
1077331964 11:1987791-1987813 CAATGGGGGGCGTGGGAGGCTGG - Intergenic
1077332059 11:1988173-1988195 CTTTGCGGGAGGTGGGAGGCGGG - Intergenic
1078523082 11:12078901-12078923 CATTTTGGGGAGTGGGATGGGGG - Intergenic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1079242135 11:18728736-18728758 CATATTGGGGAGTGGGGGGCAGG - Exonic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1079566576 11:21890257-21890279 CATTTTGTGCACTGGGAGTCTGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1083719588 11:64597808-64597830 CACTGAGGGTAGTGGGAGACAGG + Intronic
1083843492 11:65317412-65317434 CATTCTGGGCAGGGTGAGGGTGG - Intronic
1083930027 11:65836884-65836906 CACTGTGGCCTGTGGGGGGCTGG + Intronic
1084424304 11:69076387-69076409 CATTGAGGACTGTGGGAAGCTGG + Intronic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1085086648 11:73672335-73672357 GATTGTAGGCTGTGAGAGGCAGG + Intergenic
1085308790 11:75503878-75503900 CATTCAGGGCTGGGGGAGGCAGG - Intronic
1085517592 11:77120630-77120652 CATGGTGGTGAGGGGGAGGCGGG + Intronic
1087124338 11:94608162-94608184 CTTTGTGGGGAGTGGGAGAGAGG - Intronic
1088365789 11:109038592-109038614 AGTTGTGAGCAGTGGGAGGCAGG + Intergenic
1088520094 11:110688272-110688294 CATTGGGGGCGGGGGGAGGAGGG - Intronic
1088708292 11:112483210-112483232 CATTTAGGGCAGTGGGATGTTGG - Intergenic
1088986413 11:114913267-114913289 ATTTGTGGGCAGAGAGAGGCAGG + Intergenic
1089021050 11:115215362-115215384 CATTCTGGGTAGGGGGATGCAGG - Intronic
1089518346 11:119047866-119047888 GAGTGTGGGGAGTGGGAAGCTGG + Intronic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1202814945 11_KI270721v1_random:42967-42989 CAATGGGGGGCGTGGGAGGCTGG - Intergenic
1202815040 11_KI270721v1_random:43349-43371 CTTTGCGGGAGGTGGGAGGCGGG - Intergenic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1092181746 12:6451213-6451235 CAGTGGGGGCAGGGGGAGACGGG - Intronic
1092209396 12:6636435-6636457 AAGTGTGCTCAGTGGGAGGCAGG - Exonic
1093190964 12:16074397-16074419 CATAGAGGGCAGTGGGAGTGAGG + Intergenic
1094598428 12:31886813-31886835 CATTGTGGCCTGGGGAAGGCGGG - Intergenic
1095684285 12:45014715-45014737 CATTGTGGGGAATGGGAGCAGGG - Exonic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1095796871 12:46229196-46229218 CATTATGGGCAGTGGGATTTTGG - Exonic
1095849609 12:46787959-46787981 CATCATGGGCAGTGGGATCCTGG - Exonic
1096238179 12:49943719-49943741 CATTGTGGGCACTAGCAGGAGGG - Intergenic
1096602843 12:52742460-52742482 CATGAATGGCAGTGGGAGGCAGG + Intergenic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1100301900 12:93315308-93315330 CATTGGGTGCTGAGGGAGGCGGG - Intergenic
1101365228 12:104064530-104064552 CATTGTGGGCAGAGGGGCGGGGG + Exonic
1101662140 12:106775003-106775025 CAGTGGGGGTAGTGGGATGCAGG - Intronic
1103908016 12:124337112-124337134 CCCAGTGGGCAGTGGGTGGCAGG + Exonic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104826406 12:131712250-131712272 GATTATGGGCAGTGGGGGCCTGG + Intronic
1105430688 13:20334550-20334572 CAGTGGTGGCAGTGGGAGGTGGG - Intergenic
1105923126 13:24983514-24983536 CAATGTAGGCATTGGGAGCCAGG - Intergenic
1106405557 13:29470038-29470060 CATTTTGGGCATTAGGAGTCTGG - Intronic
1106546000 13:30731707-30731729 CTTTCTGGGCAATGGGAGGGGGG + Intronic
1106740820 13:32639036-32639058 CATTGTGGGGGGTGGGGGGGTGG - Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108035522 13:46286518-46286540 CATTGTGGGTGGGGGGAGGGGGG - Intergenic
1108497251 13:51037258-51037280 TATTGTGGATAGTGGGAGCCAGG + Intergenic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1109516815 13:63454048-63454070 AAATGTGGGAAGTGGGAGGTGGG + Intergenic
1111359243 13:87152997-87153019 CATTGTGGGGAATGGGAAGGGGG + Intergenic
1112004925 13:95245793-95245815 CACGGTGGGCAGTGGGAGGCAGG - Intronic
1113782089 13:112982585-112982607 CATTGTGTCTGGTGGGAGGCGGG + Intronic
1113808196 13:113122125-113122147 CAGTGTGGCCAGTGGTGGGCAGG + Intergenic
1113823352 13:113231434-113231456 CTGTGTGGGGAGTGGGAGGTGGG + Intronic
1114491009 14:23102021-23102043 CTCTGGGGGAAGTGGGAGGCTGG - Intergenic
1114678247 14:24460011-24460033 AGTTGGGGGTAGTGGGAGGCTGG + Intergenic
1115525582 14:34277258-34277280 CTTTTTAGGGAGTGGGAGGCAGG - Intronic
1115734895 14:36315653-36315675 CATTGTGGGGAGTGGGGGAGGGG - Intronic
1118107245 14:62673861-62673883 CAGTAGGGGCAGTGGGAGTCAGG - Intergenic
1119216798 14:72875635-72875657 CATGGTGGGGAGCAGGAGGCTGG - Intronic
1120549656 14:85854444-85854466 TAATGTGGGTAGTGGGAGGGAGG - Intergenic
1121051832 14:90824274-90824296 CATTCTGGGCAGGGGGAGATAGG - Intergenic
1121178216 14:91906797-91906819 CATTGGGGGCAGTGGGACTCGGG - Intronic
1121265649 14:92600762-92600784 CATTGTTGGCATTTGGAGCCGGG + Intronic
1122786150 14:104164149-104164171 CAGTGGGGGCAGCGAGAGGCCGG + Intronic
1123121169 14:105917810-105917832 AGTTGTGGGCAGGAGGAGGCAGG + Intergenic
1123122873 14:105926281-105926303 CCAGGTGGGCAATGGGAGGCAGG - Intronic
1123405516 15:20017701-20017723 CCAGGTGGGCAATGGGAGGCAGG - Intergenic
1123514848 15:21024349-21024371 CCAGGTGGGCAATGGGAGGCAGG - Intergenic
1124638236 15:31378518-31378540 CATCGGAGGCAGTGGGAAGCTGG + Intronic
1127324725 15:57883956-57883978 ATGTGTGGGGAGTGGGAGGCAGG - Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1130067276 15:80615196-80615218 TAGTGTGGGCAGTGGGTGGAGGG + Intergenic
1130230354 15:82092263-82092285 CACTGTGGGGTGTGGGAGTCCGG - Intergenic
1130360345 15:83179160-83179182 CACCAGGGGCAGTGGGAGGCAGG - Intronic
1130609434 15:85347532-85347554 CATTGTGGGTATTGGGACTCTGG + Intergenic
1131250499 15:90827181-90827203 CTTCGTGTGCAGTGGGAGCCTGG + Intergenic
1131432863 15:92400717-92400739 CACTGTGGGCAGTGGAGGGCTGG - Intronic
1133056382 16:3147490-3147512 AAGTGAGGGCAGTAGGAGGCCGG - Intronic
1133157482 16:3885286-3885308 TATTTGGGGCAGTGGGAAGCAGG + Intergenic
1134072366 16:11268784-11268806 CCTTGGGGGCAGTGAGAGGAAGG - Intronic
1136043144 16:27596048-27596070 CTCTGGGGGCAGTGGGAGCCAGG + Intronic
1136141345 16:28290961-28290983 CATCGTGGGCTGTGCGTGGCTGG - Intergenic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1141114807 16:81299435-81299457 CTTTGTATGCAGTGTGAGGCAGG + Intergenic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1143367263 17:6416215-6416237 CATTGTGGGGAGTGGGCGAGGGG - Intronic
1143473448 17:7190421-7190443 CATTGGGGGCAGGTGGGGGCGGG + Exonic
1144839642 17:18177983-18178005 CATTGTGCACTGTGGGAGCCAGG + Intronic
1146593031 17:34145157-34145179 AAGTGTGGGAAGTGGGTGGCTGG - Intronic
1146820791 17:35982447-35982469 TGTTGAGGGCAGTGGGAGGCAGG + Intergenic
1147441080 17:40447562-40447584 CCTTGTGGGGAGGGGGAGGGAGG + Intronic
1147538433 17:41335614-41335636 CCTTGAGGGCACTGGGAGGTGGG + Intergenic
1147623477 17:41883910-41883932 CCTGGTGGGCAGTGGAAAGCTGG - Intronic
1148102219 17:45099241-45099263 CACTGTGGGGAGGGGGAGGCTGG + Intronic
1148784999 17:50141807-50141829 CTGTGTGGGCAGTGAGAGCCAGG + Intronic
1148911675 17:50946348-50946370 CATTGAGGGCGGAGGGAGCCTGG + Intergenic
1149567172 17:57648634-57648656 CACTCTGGGCAGTGGGGTGCTGG + Intronic
1150004125 17:61459165-61459187 CATTGAGGACAGTGGAAGCCAGG + Intronic
1150103943 17:62448002-62448024 CATTTTGGACAGTGGCAGACAGG - Intronic
1151320891 17:73351839-73351861 CAATGTGGGCAATGTGTGGCAGG + Intronic
1151457264 17:74233472-74233494 CCTTGGGGTCAGCGGGAGGCTGG + Intronic
1151541504 17:74767227-74767249 TATGGTGGGGAGTTGGAGGCGGG - Intronic
1151818114 17:76481522-76481544 CATTGTGGGCAGGAGGCGGGAGG + Exonic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1152296156 17:79468011-79468033 CAAAGTGGGAAGTGAGAGGCAGG - Intronic
1152813580 17:82393898-82393920 CCTCGTGAGCTGTGGGAGGCAGG + Intronic
1153553314 18:6284872-6284894 CAGCGTGGGCAGTCGGAGCCCGG + Intronic
1154411322 18:14143624-14143646 CACTGTGGGCAGCGGGAGCGGGG + Intergenic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1156560767 18:38122991-38123013 CATTGTTGGGGGTAGGAGGCAGG + Intergenic
1157424886 18:47576564-47576586 CATTAAGGTCAGTGAGAGGCAGG + Intergenic
1157834688 18:50889446-50889468 CATTGGGGGCAAGGGGATGCAGG - Intronic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1161287025 19:3473874-3473896 CATTGTGGCCAGGCTGAGGCTGG + Intergenic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163980788 19:20897963-20897985 CATTGTGGTGAATGAGAGGCTGG - Intergenic
1164593588 19:29519525-29519547 CATAGGGGGCAGTGGGAGCTGGG - Intergenic
1165258106 19:34592188-34592210 CATTTTGGGCAGTGGGAGTGAGG + Intergenic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165903506 19:39179571-39179593 CATTCTGGGGAGTGGCAGGCTGG - Intronic
1166048999 19:40246993-40247015 TAGGGTGGGCAGTGGGAGCCAGG - Intronic
1166705845 19:44907633-44907655 CATGGTGGGCAGGGTGAGGGGGG - Intronic
1166855505 19:45781009-45781031 CATTAGGGGCTGTGGGAGGTTGG + Intronic
1166975786 19:46604260-46604282 CATGGTGGGAGGTGGGGGGCAGG + Intronic
1167770073 19:51509359-51509381 CCCTGAGGGCAGTGGGATGCGGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168171686 19:54594124-54594146 CAGTGTGGACACTCGGAGGCTGG - Intronic
1168329834 19:55561290-55561312 AAGTGTGAGCACTGGGAGGCAGG + Intergenic
925800700 2:7597501-7597523 CAAAGTGAGCAGTGGCAGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
926872420 2:17437071-17437093 AATTTTGGGGAGTGGGAGGTGGG + Intergenic
927642866 2:24856521-24856543 CAGAGGGGGCTGTGGGAGGCAGG + Intronic
929520665 2:42647540-42647562 GACTGCTGGCAGTGGGAGGCGGG - Intronic
929862248 2:45689383-45689405 GATTGGGGGTCGTGGGAGGCCGG - Intronic
933594972 2:84274191-84274213 TTTTGTGGGTAGTGAGAGGCTGG - Intergenic
933778585 2:85786614-85786636 CACAGTGGGTAGTGGGAGCCAGG - Intronic
937978496 2:127596582-127596604 CACTGTGGGCAGGAGTAGGCTGG - Intronic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
942396550 2:175555891-175555913 CAATGTAGGCAGTGTGAGCCTGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946008871 2:216548901-216548923 CATAGAAGGCAGTGGAAGGCAGG + Intronic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
946921620 2:224585791-224585813 CATGGTGGGGAGTGGGAGGGGGG + Intergenic
947987995 2:234465281-234465303 CACTGTGGGCAGTGGGGCTCAGG + Intergenic
948347126 2:237308055-237308077 CACTGTGGTGAGTGGGCGGCTGG - Intergenic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948606423 2:239138731-239138753 CATTGTGTGGAGTGTGGGGCAGG + Intronic
948660093 2:239501703-239501725 CAGTGTGGGGAGTGGGAGATTGG + Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948775269 2:240284720-240284742 CTGTGTGGGCAGTGGGACCCGGG + Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168970394 20:1926864-1926886 CACTGTGAGCATTGAGAGGCTGG - Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1170718230 20:18850831-18850853 CTGTGTGGGCAGTTGGGGGCTGG - Intergenic
1172929914 20:38579247-38579269 CAAAGGGGGCAGTGGGCGGCAGG - Intergenic
1174461227 20:50684413-50684435 AATTGTGGGGAGTGGGAAGGAGG + Intronic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175978467 20:62725383-62725405 CACAGTGGGAAGCGGGAGGCGGG + Intronic
1178465119 21:32840972-32840994 GATGGTGGGCAGTGGAAAGCAGG - Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178921139 21:36739012-36739034 GATTGTGGGGGTTGGGAGGCAGG - Intronic
1179376396 21:40853306-40853328 CAGTGATGGCAGTGGGAGGGTGG - Intergenic
1179898407 21:44376335-44376357 CATTTTAGCCAGTGGGAGGGCGG + Intronic
1179930552 21:44568455-44568477 CCTTGGGTGCTGTGGGAGGCTGG + Intronic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180998662 22:19977806-19977828 CAGTGTGGTCACTGCGAGGCGGG + Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183684740 22:39355216-39355238 CTCTGAGGGCAGTGGGAAGCTGG + Intronic
1183689049 22:39377786-39377808 CATGCAGGGCAGTGGAAGGCTGG + Intronic
1184289130 22:43489009-43489031 CAGTGTGGGCAGTGAGGGGTGGG + Intronic
1184522336 22:45002536-45002558 CGTTGTGGGGAGCGCGAGGCTGG - Intronic
1184747036 22:46462068-46462090 AGGTGTGGGCTGTGGGAGGCGGG + Intronic
1184873770 22:47259433-47259455 AATTCAGGGCAGGGGGAGGCAGG + Intergenic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
950574155 3:13821167-13821189 AATTGGGGGCAGAGTGAGGCAGG + Intronic
950790815 3:15470461-15470483 CAGTGTGTGGAGTGGCAGGCAGG - Intronic
951711265 3:25586576-25586598 CAGTAAGGGCAGTGGGTGGCAGG - Intronic
952649047 3:35700869-35700891 CATGTCGGGCAGTGGGGGGCTGG + Intronic
953133914 3:40166678-40166700 CATGGGAGGCAGTGTGAGGCAGG + Intronic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
955289469 3:57677680-57677702 CAATTTGGGAGGTGGGAGGCAGG - Intronic
956791136 3:72680912-72680934 CATCGTGGGAAGTGGGAGGCAGG - Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
958085363 3:88798739-88798761 CATGGTGGGTAGAGGGATGCTGG - Intergenic
960272518 3:115690221-115690243 AATGGTGGGCAGGGGGTGGCGGG - Intronic
961550598 3:127668625-127668647 CCAGGAGGGCAGTGGGAGGCGGG + Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
961988654 3:131164172-131164194 CATTGTGAGCAGTGGTGTGCTGG + Intronic
962298899 3:134219382-134219404 CAATGTGGGAAGTGGCAGTCAGG - Intronic
962491401 3:135897194-135897216 CTTTTTGGGGGGTGGGAGGCAGG - Intergenic
962637501 3:137346144-137346166 CATTATGGGCAGTGGGACAAAGG - Intergenic
963963123 3:151332890-151332912 CATTGAGGGTAGTGGGTGGGAGG - Intronic
964015218 3:151936908-151936930 AAATGTGGGAAGTGGGAGGCAGG + Intergenic
966583992 3:181601335-181601357 GATTCTGGGCAGTGGCAGGGAGG + Intergenic
967853596 3:194100168-194100190 CCTTGTGGGCGGTGGGTGGTGGG - Intergenic
968144542 3:196287501-196287523 CAGCGAGGGCAGTGGGAGCCAGG - Intronic
968447650 4:660434-660456 GATTGTGGGCTGAGGGAGGTTGG - Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968949126 4:3681352-3681374 CGTTGTGTGCAGGCGGAGGCAGG + Intergenic
968952527 4:3702368-3702390 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968952546 4:3702416-3702438 CAGTCCGGGCAGTGGGAGGAGGG - Intergenic
968952554 4:3702440-3702462 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969078390 4:4598945-4598967 CCTTTTTGTCAGTGGGAGGCTGG + Intergenic
969091415 4:4696623-4696645 CATCTTGTGCTGTGGGAGGCAGG + Intergenic
969459543 4:7321749-7321771 CATTGTGGGCAGGGGACAGCTGG + Intronic
970583440 4:17493694-17493716 CATGGAGGGCACTGGGAGGGTGG - Intronic
971349286 4:25842375-25842397 CTTCGTGGGCAGGGGGAGTCGGG + Intronic
972552187 4:40144168-40144190 CCATGTGGGCAGCTGGAGGCTGG - Intronic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
975345595 4:73289478-73289500 CATTGTGGCCTGTCGGGGGCTGG - Intergenic
977310273 4:95377696-95377718 CTTTGTGAGGAGTGGGAGTCTGG + Intronic
977762707 4:100758913-100758935 CATTGTGGGCAGGTGGAGGTAGG + Intronic
979084201 4:116385714-116385736 CAATGTGGGAAGTGGCATGCAGG + Intergenic
979169290 4:117579962-117579984 TATGGTGTGCAGTGGGAGGTAGG - Intergenic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981413654 4:144462542-144462564 CATTGTGGGGAGTGGCAAGGAGG + Intergenic
981703946 4:147639975-147639997 CAGTGTGGGGATTAGGAGGCAGG - Intronic
981727247 4:147861292-147861314 CATTGTGGGCACTGGGAACACGG + Intronic
984250082 4:177321216-177321238 CTTGGTGGGCAGTGGGAGTGGGG - Intronic
984254416 4:177373904-177373926 CAGTGAGTGCAGTGGGAGTCAGG + Intergenic
984417360 4:179478353-179478375 CATTAAGGGCAGTGGGAAGCAGG + Intergenic
984528863 4:180890681-180890703 AAATGGGGGTAGTGGGAGGCAGG - Intergenic
985388330 4:189468170-189468192 CGCTGTGGGCAGTGAGGGGCTGG - Intergenic
985698705 5:1357867-1357889 CATGGAGAGCTGTGGGAGGCTGG - Intergenic
986072192 5:4296354-4296376 CATTCTTGTCAGTGAGAGGCTGG - Intergenic
986479605 5:8173239-8173261 CATTGTGCTCAGTGCAAGGCGGG - Intergenic
991214838 5:64149721-64149743 CACTGTGGGGATTGGGAGGGTGG + Intergenic
992269239 5:75049421-75049443 CAGTGTGGGCATTTGGAGACAGG - Intergenic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
995213382 5:109566994-109567016 AACTGAGGGCAGTGGGAGGCAGG + Intergenic
995433023 5:112103532-112103554 AATTGTGGGCAGTGGTTGGTGGG + Intergenic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
999738910 5:154534392-154534414 GTTTGCGGGCAGTGGGAGGAAGG + Intergenic
999837449 5:155389811-155389833 CACTGTGATAAGTGGGAGGCTGG - Intergenic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1000362858 5:160464301-160464323 AAGTGTGGGCTGTGGCAGGCAGG + Intergenic
1002327399 5:178418765-178418787 GCTTGTCGGCACTGGGAGGCAGG + Intronic
1003887662 6:10535758-10535780 CTTTGTGGGCGGTGGGAGGAAGG + Intronic
1005140663 6:22627888-22627910 AAGTGTGGGCAGTGGGAGCTGGG + Intergenic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006698339 6:35951103-35951125 GATTGAGGGCAGTGGGGGGATGG - Intronic
1007124251 6:39411588-39411610 TATTGTGTGCAGAAGGAGGCTGG + Intronic
1008152634 6:47973570-47973592 GATTGTGGGCAGTTGGAGAAAGG + Intronic
1010603084 6:77854973-77854995 CATTGTGGGGGGTGGGAGGGGGG + Intronic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1012274682 6:97258652-97258674 CATTGTGGGTAATTGGAGTCAGG - Intronic
1012398305 6:98824629-98824651 GATTGTGGGGATGGGGAGGCGGG - Intergenic
1012531085 6:100237271-100237293 CAATGCAGGCGGTGGGAGGCAGG - Intergenic
1013004025 6:106053826-106053848 CATTGTGGGGGGTGGAGGGCTGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014787071 6:125631341-125631363 GCTTGGGGCCAGTGGGAGGCAGG - Intergenic
1016223453 6:141704878-141704900 CATTGTGGACAATGTGGGGCTGG + Intergenic
1017018316 6:150118953-150118975 CAGTGCGGGGAGTGGGAGGCTGG + Intergenic
1017694692 6:157003032-157003054 AAGTGTAGGAAGTGGGAGGCCGG + Intronic
1017760237 6:157562868-157562890 CTTGGGGGGCGGTGGGAGGCGGG - Intronic
1018631438 6:165826234-165826256 AATTGAGGGCAGTGGCAGGATGG + Intronic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1019351004 7:553948-553970 CACTGTGGGCAGGGGGAGACAGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019404727 7:877416-877438 GAGTGAGGGCAGGGGGAGGCCGG - Intronic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1020438619 7:8193399-8193421 AGTTGTGGACAGTGGGAGCCAGG - Intronic
1023528548 7:41130185-41130207 GAGGGTGGGCAGTGGGTGGCAGG - Intergenic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1024325865 7:48108889-48108911 CATTGTGGACAATGGGTGGGAGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1026205545 7:68254491-68254513 CACTCTGGGCAGTGGCAGACAGG + Intergenic
1026828830 7:73599658-73599680 CATGGGCGGCTGTGGGAGGCGGG + Exonic
1028983218 7:96989778-96989800 TGGGGTGGGCAGTGGGAGGCCGG - Intergenic
1030237865 7:107286361-107286383 CATGGTGGGCTGATGGAGGCTGG - Intronic
1031274642 7:119704644-119704666 CATTGTAAGTAGTGAGAGGCAGG - Intergenic
1032033124 7:128501199-128501221 CATTTTGGACAGTGGCAGACAGG - Intronic
1032429605 7:131849945-131849967 GATTTTGGGCAGTGGCAGCCTGG + Intergenic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1033494145 7:141876953-141876975 CAGTGTGGGGAGGGGCAGGCAGG + Intergenic
1033510042 7:142051350-142051372 CATTGTTGGGAGTGGGAGTGGGG + Intronic
1033512834 7:142077329-142077351 CATTGTTGGGAGTGGGAGTGGGG + Intronic
1033578475 7:142709759-142709781 CATTCTGGGCGGTGGGGGGAAGG - Intergenic
1033662671 7:143413145-143413167 CCGTGTGGGCTGTGGGAGGGAGG + Intergenic
1034395432 7:150820945-150820967 CACTGTGGGTTGGGGGAGGCAGG - Intergenic
1034558881 7:151867098-151867120 TGCTGTGGGCAGTGGGACGCTGG + Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035397340 7:158543889-158543911 CCTTGTGGGCAGGGGCAGCCTGG - Intronic
1036258488 8:7222829-7222851 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036308132 8:7616679-7616701 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036310543 8:7681425-7681447 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036358988 8:8064680-8064702 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036675101 8:10825067-10825089 GATTGTGTGCAGGGAGAGGCTGG - Intronic
1036704151 8:11034227-11034249 CAGTGTGGGAAATGAGAGGCTGG + Intronic
1036754687 8:11464448-11464470 CATGGTGGGCAGGGGGAGGTGGG - Intronic
1037415430 8:18644635-18644657 CATTGTGGGCAGTTGGGTGAGGG - Intronic
1037619896 8:20554593-20554615 CATTGTGGGCAGGCAGAGGGAGG - Intergenic
1038562229 8:28590354-28590376 CACAGGGGGCAGTGGGAGTCAGG - Intergenic
1039816343 8:41097910-41097932 CGTTCTGGGAAGTGGGAGACAGG + Intergenic
1043077384 8:75719282-75719304 CATTGTGGGAAATGGCTGGCAGG - Intergenic
1043821254 8:84868090-84868112 CATGATGGGCAGTGGGGGGTAGG + Intronic
1046072922 8:109280522-109280544 GATTGTGAGGAGTGGGAGGATGG + Intronic
1047037892 8:120959760-120959782 GGTTGGGGGCAGTGGGAGCCCGG + Intergenic
1047205914 8:122802928-122802950 GAGTGGGGGCAGTGGGATGCAGG - Intronic
1047863060 8:128990173-128990195 CATTGAGGGCATTGTTAGGCAGG + Intergenic
1048329415 8:133461847-133461869 CCCTGTGGGCAGGGGGAGGGTGG + Intronic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049594937 8:143479000-143479022 TATGGTGGGCAGTGGGGGGCTGG - Intronic
1049629383 8:143644472-143644494 CTTGCTGGGCAGTGGGAGCCGGG - Intronic
1050596616 9:7210960-7210982 CCTTTTGGGAGGTGGGAGGCAGG - Intergenic
1051160665 9:14204228-14204250 CATCTTGGGCAGTGGACGGCGGG - Intronic
1051635680 9:19179070-19179092 CACTTTGGGAAGTTGGAGGCAGG - Intergenic
1054760902 9:69003133-69003155 TAACGTGGGCAGAGGGAGGCGGG + Intronic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1056442496 9:86634736-86634758 CACTGGAGGCAGTGAGAGGCTGG + Intergenic
1056638322 9:88349284-88349306 CATTTCTGGCATTGGGAGGCAGG - Intergenic
1056964053 9:91151695-91151717 GATGGTGGGCAGTGGGGGGGAGG - Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057877294 9:98767789-98767811 AAATGTGTGCAGTGTGAGGCTGG + Intronic
1057951660 9:99373867-99373889 ATTTGTGGGGAGTGGCAGGCAGG - Intergenic
1059268937 9:113060595-113060617 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059270073 9:113066044-113066066 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059271207 9:113071492-113071514 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059272340 9:113076938-113076960 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059273475 9:113082380-113082402 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059274611 9:113087826-113087848 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1061917737 9:133763935-133763957 CCCTGTGGGCAGTGGAAGACTGG + Exonic
1061986729 9:134134578-134134600 AATTGAGGGCAGTGGGAAGCTGG + Intergenic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1186098753 X:6132174-6132196 CACTGTGGGCATTTGGGGGCTGG + Intronic
1187434237 X:19252611-19252633 TATAGTGGGGAGTGGGGGGCAGG - Intergenic
1190444058 X:50505400-50505422 CATTGTTGGCAAAGGGAGGAGGG + Intergenic
1191204767 X:57822135-57822157 CAGAGTGGGCTGTCGGAGGCTGG + Intergenic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1195255899 X:103090671-103090693 CTTTTGGGGCAGGGGGAGGCGGG + Intronic
1195751233 X:108163288-108163310 CATTGTGCCCAGTGGGTGACAGG + Intronic
1195761145 X:108247758-108247780 AATTGGTGGCAGTGGGGGGCAGG - Intronic
1197492881 X:127140294-127140316 CCTGGTGGGTAGTGGGAGGGGGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1199544159 X:148989768-148989790 CATTGTGGGCAGTATGAGGCAGG - Intronic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1199895825 X:152127316-152127338 CATTGTCGTGAGTGGGAGGGGGG - Intergenic
1200053567 X:153447005-153447027 CACTGTGAGAGGTGGGAGGCCGG - Intronic
1200075583 X:153549092-153549114 CAATGTGGGCAGTAGGACGGAGG + Intronic
1200842058 Y:7792447-7792469 CATGGTGGAGAGTAGGAGGCTGG - Intergenic
1201567735 Y:15384378-15384400 CCCTGTGGACAGTGAGAGGCTGG + Intergenic
1202047539 Y:20749798-20749820 CATTGTGGGAAAGTGGAGGCAGG - Intergenic
1202380564 Y:24273667-24273689 CATTGTGGGTATTGGGACTCTGG + Intergenic
1202490220 Y:25396458-25396480 CATTGTGGGTATTGGGACTCTGG - Intergenic