ID: 1056985994

View in Genome Browser
Species Human (GRCh38)
Location 9:91364185-91364207
Sequence TTCCCACCCCAACTCAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 2, 1: 8, 2: 28, 3: 71, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056985994_1056986001 13 Left 1056985994 9:91364185-91364207 CCCCTTCTGAGTTGGGGTGGGAA 0: 2
1: 8
2: 28
3: 71
4: 248
Right 1056986001 9:91364221-91364243 TCTGCAGCACAGCTGCAGACTGG No data
1056985994_1056986003 15 Left 1056985994 9:91364185-91364207 CCCCTTCTGAGTTGGGGTGGGAA 0: 2
1: 8
2: 28
3: 71
4: 248
Right 1056986003 9:91364223-91364245 TGCAGCACAGCTGCAGACTGGGG No data
1056985994_1056986002 14 Left 1056985994 9:91364185-91364207 CCCCTTCTGAGTTGGGGTGGGAA 0: 2
1: 8
2: 28
3: 71
4: 248
Right 1056986002 9:91364222-91364244 CTGCAGCACAGCTGCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056985994 Original CRISPR TTCCCACCCCAACTCAGAAG GGG (reversed) Intergenic
900218856 1:1496353-1496375 TTCAGACCCCAACTCGGATGTGG - Intronic
901691046 1:10973675-10973697 TTCCCGTCCCAACTCAGAAGGGG - Intronic
901873647 1:12153357-12153379 TCCCCTCCCCAATTCAAAAGAGG - Intergenic
902644890 1:17791189-17791211 CTCCTGCCCCAACTCGGAAGGGG + Intronic
903035802 1:20491839-20491861 ACCCCACCCCAGTTCAGAAGGGG + Intergenic
903082217 1:20820032-20820054 CTTCCATCCCAACTCAGAAGGGG - Intronic
903672259 1:25043380-25043402 ATCCCGCCCCAACTCAGAAGGGG + Intergenic
904323477 1:29711732-29711754 TTCTCACCACAACCCAGACGTGG + Intergenic
907603528 1:55793834-55793856 CTCCTGCCCCAACTCAGAAGGGG - Intergenic
910494031 1:87806062-87806084 TTTCCTCCCCAACTCGGCAGAGG - Intergenic
910549549 1:88460337-88460359 ATCCCACCCCCACTGAGATGTGG - Intergenic
911024896 1:93426368-93426390 CTGCCCCACCAACTCAGAAGGGG - Intergenic
911539938 1:99146346-99146368 TTCCCACTCCAACTTGGATGGGG - Intergenic
912651100 1:111440418-111440440 TTCCCACCCCAAAACAGCATGGG - Exonic
913329482 1:117655156-117655178 TTCCCAGCCCCACTCAGCATGGG - Intergenic
915167119 1:153954170-153954192 TCCCAGCCCCAACCCAGAAGGGG + Intronic
915845463 1:159259449-159259471 ATCCCACTCCAACACAGAAGAGG + Intergenic
916648986 1:166817196-166817218 CTCCTGCCCCAACTCAGAAAAGG + Intergenic
918044458 1:180933358-180933380 TTATCACACCAACCCAGAAGAGG - Intronic
919165445 1:193885640-193885662 CTCCTATCCCAACTCAGAAGGGG + Intergenic
919191910 1:194230963-194230985 CTCCCACCCCAACTCAGAAGGGG + Intergenic
920046438 1:203135912-203135934 TGCCCAACCCAGCCCAGAAGGGG - Intronic
920118254 1:203636505-203636527 CTCCCTCACCAACACAGAAGGGG - Intronic
920249861 1:204616404-204616426 TTCCCAGCCTATCTCAGAAACGG + Intergenic
920269407 1:204752052-204752074 CTCGCGTCCCAACTCAGAAGGGG - Intergenic
921146778 1:212365986-212366008 TTTCCTCCCAAACTCAGAGGAGG + Intronic
921902171 1:220462903-220462925 CTCCCATCCCAACTCAGAAGGGG - Intergenic
922132597 1:222794843-222794865 CTCCTGCCCCAACTCAGAATGGG - Intergenic
923245617 1:232128971-232128993 ACCCCTCCCCAACTGAGAAGAGG - Intergenic
923755161 1:236785393-236785415 CTGCCTCACCAACTCAGAAGGGG - Intergenic
1063174320 10:3538056-3538078 TTCCCACCCCATGACAGATGAGG + Intergenic
1064107574 10:12513039-12513061 TGCCCAGGCCAGCTCAGAAGAGG + Intronic
1064244563 10:13658511-13658533 TTCCGACTGCCACTCAGAAGGGG + Intronic
1064441063 10:15354159-15354181 ATCCCTCCCCACCTCTGAAGTGG + Intronic
1066525426 10:36274161-36274183 TTCCCACCCGCACTCTGCAGTGG + Intergenic
1067686549 10:48469283-48469305 TGCCCACCCCACCTCAGGGGTGG + Intronic
1068060785 10:52064729-52064751 CTCCCATCCCAACTCAGAAGGGG + Intronic
1068967238 10:62924714-62924736 CTCCCGCCCCAACTCAGAAGGGG + Intergenic
1069626239 10:69869294-69869316 TTCTGAGCCCAGCTCAGAAGAGG + Intronic
1069724482 10:70568525-70568547 TGCCCACCCTTACTCTGAAGGGG - Intergenic
1072335693 10:94395955-94395977 CTCCCACCCCAGCTCAGAAGGGG + Intergenic
1072470368 10:95707374-95707396 CTCCCACCCCAATTCAGAAAGGG + Intergenic
1072654810 10:97322491-97322513 TTCCCTTCCCACTTCAGAAGTGG - Intergenic
1073441158 10:103553622-103553644 TCCCCAGACCCACTCAGAAGTGG + Intronic
1074396570 10:113102773-113102795 ATCCCACTCCCACTAAGAAGAGG - Intronic
1074991652 10:118713383-118713405 CTCCCACCCCAACTCAGAAGAGG + Intronic
1075007604 10:118842114-118842136 CTCCCACCCCAACTTGGAAGGGG - Intergenic
1076492931 10:130875856-130875878 TTCTGAGCCCCACTCAGAAGTGG - Intergenic
1076570201 10:131427467-131427489 TTCCCATCCCATCTCGTAAGCGG + Intergenic
1076842450 10:133052451-133052473 TGCCCACCACATCTCAGGAGAGG - Intergenic
1077076614 11:705218-705240 TTCCCACCCCTACCCAGGACCGG + Intronic
1078042897 11:7884565-7884587 CTCCAACCCCAACTCGGAACAGG + Intergenic
1078578338 11:12519553-12519575 TTCCTCCCCCAAGACAGAAGTGG - Intronic
1078836561 11:15035542-15035564 CTCCCGCTCCCACTCAGAAGGGG + Intronic
1079504106 11:21133881-21133903 CTACCCCACCAACTCAGAAGTGG + Intronic
1080584149 11:33666244-33666266 CTCCTGCTCCAACTCAGAAGGGG + Intronic
1081268453 11:41056928-41056950 ACCCCACCCCTACTCAGTAGAGG + Intronic
1084991017 11:72925811-72925833 CTCCCGTCCCAACTCAGAAGGGG - Intronic
1086092623 11:83020056-83020078 CTCCCTCCCCAGTTCAGAAGGGG - Intronic
1088513095 11:110598781-110598803 CTCCCACCCCAACTCAGAAGGGG - Intronic
1088540298 11:110906488-110906510 TTCCCTACTCAACTGAGAAGAGG + Intergenic
1088695533 11:112362792-112362814 CCCACACCCCAACTCAGGAGTGG + Intergenic
1089505946 11:118961851-118961873 CTCCCTTCCCAACTCAGAAGGGG + Intergenic
1089822621 11:121241780-121241802 CTGCCCCGCCAACTCAGAAGAGG + Intergenic
1089823020 11:121246088-121246110 CTTCCGCCTCAACTCAGAAGGGG - Intergenic
1090234365 11:125136388-125136410 TTCTCAAACTAACTCAGAAGGGG + Intergenic
1092501240 12:9050441-9050463 CCCCCACCCCAACTCAGAAGAGG - Intergenic
1093125167 12:15320352-15320374 TTCCCACTCGCCCTCAGAAGTGG - Intronic
1093493192 12:19726917-19726939 CACCTGCCCCAACTCAGAAGGGG + Intergenic
1095042175 12:37455436-37455458 CTCTCATTCCAACTCAGAAGGGG - Intergenic
1095145346 12:38720794-38720816 CTCCTACCCCAACTCGGAAAAGG - Intronic
1095727370 12:45468958-45468980 CTCCCACTCCAGCCCAGAAGGGG - Intergenic
1096172091 12:49479608-49479630 TTCCTGCCCCAACTCAGAAGGGG + Intronic
1096602718 12:52741945-52741967 GTCCCGCCCCAACTCAGAAGAGG - Intergenic
1097131027 12:56810743-56810765 CTGCCCCACCAACTCAGAAGTGG + Intergenic
1097299139 12:57998794-57998816 CTCCCATCCCAACTCAGAAAAGG + Intergenic
1098250076 12:68560392-68560414 TTCCCACCCCCAGTCAGCAGGGG - Intergenic
1098597992 12:72295252-72295274 GCCCCACCCCAGCTCAGAAGGGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099833630 12:87878285-87878307 TCCCCACTCTAACCCAGAAGAGG + Intergenic
1099911932 12:88844647-88844669 CTCCCACCCCAACTCAAAAGGGG + Intergenic
1100847742 12:98678411-98678433 CTCCTGCCCCAATTCAGAAGGGG - Intronic
1101388194 12:104276530-104276552 TCCCCACCACCACTCAGAACTGG + Intronic
1101764133 12:107682786-107682808 CTCCTGCCCCAACTCAGAAGGGG + Intergenic
1101922286 12:108942698-108942720 TTACCACCCCAGGCCAGAAGGGG - Intronic
1102060258 12:109926232-109926254 CTCCCATCCCAACCCAGAAGGGG - Intronic
1102328651 12:112011198-112011220 CTCCTGCCTCAACTCAGAAGGGG + Intronic
1103721529 12:122978042-122978064 TCTGTACCCCAACTCAGAAGTGG - Intronic
1104749484 12:131229402-131229424 TCCCCACCCCACCCCAGCAGTGG - Intergenic
1105410985 13:20171113-20171135 TTCTCTCCCAAACTCAAAAGAGG - Intergenic
1106571865 13:30934710-30934732 CTCCCATCCCAACTCAGAAGGGG - Intronic
1106620138 13:31364781-31364803 CTCCCCTCCAAACTCAGAAGGGG - Intergenic
1107513434 13:41107272-41107294 CTCCCATCCCAACTTAGAAGGGG - Intergenic
1108088161 13:46817981-46818003 CTCCCGTTCCAACTCAGAAGGGG - Intergenic
1109683636 13:65784590-65784612 CTCCCACCCTAACTCAGTAGGGG + Intergenic
1110008051 13:70297105-70297127 CTCCTGTCCCAACTCAGAAGGGG - Intergenic
1110638900 13:77798742-77798764 TTCCCACCTCAGCTCAGATATGG - Intergenic
1111000039 13:82166009-82166031 CTCCCATCCCATCTCAGAAGGGG + Intergenic
1111512811 13:89287904-89287926 CTCCCACCCCTACTCAGAAGTGG + Intergenic
1113339038 13:109404366-109404388 TTCCCGCCCCAACTCAGAAGGGG - Intergenic
1113439174 13:110314604-110314626 TTCCCTCCCCAGCGAAGAAGAGG - Intronic
1113984737 13:114304500-114304522 TTCACTTCCCAACTCAGAGGGGG + Intronic
1114349737 14:21836399-21836421 CTCCTGCTCCAACTCAGAAGGGG + Intergenic
1116257112 14:42570925-42570947 CTCCCACTCCAACTCAGAAGGGG - Intergenic
1119257289 14:73209188-73209210 CTGCCCCACCAACTCAGAAGGGG + Intronic
1120043073 14:79775654-79775676 TTACCACCCTAGGTCAGAAGTGG + Intronic
1122845275 14:104492299-104492321 TTCCCATCTCTATTCAGAAGAGG - Intronic
1124654097 15:31494837-31494859 CTCCCAGCCCCTCTCAGAAGCGG + Intronic
1124831168 15:33150946-33150968 TTCCCACCTAAACCCAGAAGAGG - Intronic
1124937416 15:34186289-34186311 CTCCTGTCCCAACTCAGAAGGGG - Intronic
1125238992 15:37550875-37550897 GTCCCGCTCCAACTCAGAAAAGG + Intergenic
1125381746 15:39093072-39093094 CTGCCACCCCAACTTAGAAGGGG + Intergenic
1125644123 15:41256714-41256736 TTCTTGCACCAACTCAGAAGTGG - Intronic
1126185884 15:45829969-45829991 CTCCGGTCCCAACTCAGAAGGGG + Intergenic
1126292768 15:47100086-47100108 CTCCCATTCCAACTCGGAAGGGG + Intergenic
1126405954 15:48322758-48322780 TCCAAACCCCAACTCAGATGGGG + Intergenic
1128790788 15:70432080-70432102 CTCCCACCACAACACAGAAAGGG + Intergenic
1128847735 15:70916730-70916752 CTCCCGCCCCAACTCGGAAGGGG - Intronic
1129784913 15:78303820-78303842 AGCTCTCCCCAACTCAGAAGGGG - Intergenic
1129910173 15:79220396-79220418 TTCCCACCCCCACAGGGAAGAGG + Intergenic
1130183031 15:81651186-81651208 CTTCCACCCCAAGTCAGAAAGGG - Intergenic
1130227869 15:82073424-82073446 CTCCAGCCCCAACTCGGAAGAGG + Intergenic
1134809099 16:17151817-17151839 TTCCAGCCCCAGGTCAGAAGTGG - Intronic
1134809205 16:17152782-17152804 TTCCAGCCCCAGGTCAGAAGTGG - Intronic
1135365688 16:21851244-21851266 TCCCCTCCCCAACTCAGATCCGG - Intronic
1135705161 16:24668669-24668691 TTCCCGCCCCCTCTGAGAAGAGG + Intergenic
1137334505 16:47534072-47534094 CTCCCACCCAAGCTCGGAAGGGG + Intronic
1137698583 16:50479041-50479063 CTCCCTTCCCAACTCAGAAGGGG + Intergenic
1138956449 16:61976447-61976469 TTCCCACCTGAACTCATCAGTGG - Intronic
1138998134 16:62477706-62477728 TGCCCCACCCAACTCAGTAGGGG - Intergenic
1139955759 16:70692294-70692316 CTCCCACCCCACCCCGGAAGTGG + Intronic
1140978646 16:80084875-80084897 TACCCATCCAAGCTCAGAAGTGG + Intergenic
1142688452 17:1591181-1591203 TTCCCACCTCACCCCAAAAGGGG - Intronic
1142819483 17:2454163-2454185 TATTCACCCCAACTCAGAAGTGG + Intronic
1144416319 17:15050693-15050715 TTACCACCCCAAAGCACAAGAGG - Intergenic
1144714368 17:17424026-17424048 CTGCCCCACCAACTCAGAAGGGG - Intergenic
1145218542 17:21070090-21070112 TTCCCACCCCAGCCCTGCAGTGG - Intergenic
1146776835 17:35626648-35626670 ATCCCATGCCAACTCAGCAGTGG + Exonic
1149085309 17:52709692-52709714 CTCCTGCCCCAATTCAGAAGGGG - Intergenic
1149107592 17:52988017-52988039 TTACCACCCCAGATCAGGAGAGG - Intergenic
1149160518 17:53687262-53687284 CTGCCCCACCAACTCAGAAGGGG + Intergenic
1149582818 17:57763052-57763074 TCCCCACCCCAAGTCATTAGGGG + Intergenic
1151289643 17:73140357-73140379 TTCCCACCTCCACTGTGAAGAGG - Intergenic
1152037925 17:77884622-77884644 TCCCCACCTCAACTCAGATGAGG + Intergenic
1154507855 18:15060549-15060571 CTACCACCCCAACTCAGAAGGGG - Intergenic
1155120851 18:22816967-22816989 CTCCCACCCCAACTCAGAAAGGG + Intronic
1156245685 18:35295593-35295615 CTTACACCCCTACTCAGAAGTGG - Intergenic
1157075908 18:44467238-44467260 TTCTCTGCCTAACTCAGAAGAGG - Intergenic
1157450203 18:47780585-47780607 TGCCCACCCCAGCTGACAAGTGG + Intergenic
1158139627 18:54242412-54242434 CTGCCCCACCAACTCAGAAGCGG + Intergenic
1158720139 18:59917417-59917439 TCCCCACCCCAGCGCAGCAGAGG - Intergenic
1158773688 18:60552635-60552657 CTCCTGTCCCAACTCAGAAGGGG - Intergenic
1159186570 18:64983574-64983596 CTCCCACCCCAACTTGGAAGAGG - Intergenic
1159464237 18:68759986-68760008 ATCTCACCCCAACTTGGAAGGGG + Intronic
1160283996 18:77522093-77522115 TTCCCACCGCCACTGAGAAGAGG + Intergenic
1161336165 19:3714770-3714792 TTCCCACAAGCACTCAGAAGGGG + Intronic
1161780039 19:6285926-6285948 CTCCCACCCCAATGCAGAAGGGG - Intergenic
1161781679 19:6297341-6297363 ATCTCATCCCAACTCAGGAGGGG - Intergenic
1161933831 19:7358628-7358650 TGCCCAACCCAACACAGCAGAGG + Intronic
1163721610 19:18900545-18900567 GTCCCACCCCACCTCTGAGGAGG - Intronic
1165022501 19:32935992-32936014 CTGCCCCACCAACTCAGAAGGGG - Intronic
1166731740 19:45062981-45063003 TTCCCACCCCCATTCCGAAGAGG - Intronic
1167013025 19:46821547-46821569 CTCCCACCACAGCTCAGAAGGGG - Intergenic
1168084413 19:54034820-54034842 CTCCCGCCCCAACTCGGAAGGGG - Intergenic
926859413 2:17292366-17292388 CTCCCACCCCAACTCAGAAGGGG + Intergenic
927072775 2:19547981-19548003 CTCCCATCCCAACTCAGAAGGGG - Intergenic
931236009 2:60413129-60413151 CTCCTACCCCTTCTCAGAAGGGG - Intergenic
931499906 2:62854871-62854893 CTCCAGCCCCAACTCAGAAGGGG - Intronic
933042474 2:77487181-77487203 CTGCCCCACCAACTCAGAAGGGG - Intronic
933267381 2:80196527-80196549 TACCCATACCAACTCAGCAGTGG + Intronic
933624798 2:84586245-84586267 CTCCCACCCCAACTTGGAAGGGG + Intronic
933770922 2:85743483-85743505 TTCCCTGCCCCACTCAAAAGAGG + Intergenic
938103202 2:128512282-128512304 TACCACCCCCAGCTCAGAAGGGG - Intergenic
938195061 2:129319520-129319542 CTCCCGTCCCACCTCAGAAGGGG + Intergenic
938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG + Intergenic
942089743 2:172478446-172478468 TCCCCACCAGAACTCAGAATGGG - Intronic
943023147 2:182599053-182599075 CTCCTGCCCCAACTCAGAAGGGG - Intergenic
943023559 2:182602256-182602278 CTTCTGCCCCAACTCAGAAGGGG + Intergenic
944821797 2:203440017-203440039 TTTCCACGCCCACTCAGAACAGG + Exonic
944853502 2:203743967-203743989 TGTTCACCCCAACTCAGAACTGG - Intergenic
945571082 2:211468600-211468622 TACATACACCAACTCAGAAGAGG + Intronic
946125477 2:217558815-217558837 TTCCCACCACAGCTCAGAGAGGG + Intronic
946318795 2:218936141-218936163 TTCCCACCCCTACTCAGGCTTGG - Intergenic
946828579 2:223704773-223704795 TTCCATCCCCAACACAGATGAGG + Intergenic
948476215 2:238221450-238221472 CTCCTGCCCCAGCTCAGAAGGGG + Intergenic
948575621 2:238947542-238947564 CTCCCATCCCAACTTGGAAGAGG + Intergenic
1171536609 20:25898508-25898530 CTCCCATTCCAACTCAGAAGGGG - Intergenic
1171804496 20:29662649-29662671 CTCCCATTCCAACTCAGAAGGGG + Intergenic
1171839551 20:30193773-30193795 CTCCCATTCCAACTCAGAAAGGG - Intergenic
1172773376 20:37394053-37394075 CTCCCACCCCAGCCCAGGAGAGG - Intronic
1173500576 20:43549884-43549906 TTCCTACCACAACCCAGTAGGGG + Intronic
1173858409 20:46266240-46266262 TTCCCACCCCAGCCCAGAGTAGG - Intronic
1173918635 20:46727675-46727697 ATCCCACCACACCTCAGAATGGG - Intronic
1174366379 20:50059077-50059099 CTCCCACCCCACCTCTGAACTGG + Intergenic
1174503273 20:51000933-51000955 TTCCCAGCCCTGCTCAGAGGTGG + Intergenic
1175064305 20:56272362-56272384 CTGCCCCACCAACTCAGAAGGGG - Intergenic
1175873302 20:62218388-62218410 TTCTGCCCACAACTCAGAAGTGG + Intronic
1176790227 21:13311250-13311272 CTACCACCCCAACTCAGAAGGGG + Intergenic
1177989400 21:28019459-28019481 CTACCACCCCAACTCAGAAGGGG + Intergenic
1179506285 21:41844102-41844124 TTCCTACACCAACTCACAAAAGG + Intronic
1180746205 22:18090752-18090774 CTCCCATCCCACCACAGAAGAGG - Exonic
1180999039 22:19979425-19979447 TTCCCACCCCAACCGTGCAGTGG - Intronic
1182688844 22:32141875-32141897 TGCTCACTCCGACTCAGAAGGGG + Intergenic
1184054526 22:42035447-42035469 CTCTCACCCCAACTTGGAAGGGG + Intronic
1184561058 22:45263141-45263163 CTGCCACCCCGACTCAGAATGGG + Intergenic
1184613496 22:45622020-45622042 CTCCCGTCCCAACTCAGAAGGGG - Intergenic
1184846280 22:47089851-47089873 TTCACAGCCCAACTTACAAGGGG + Intronic
950031286 3:9855539-9855561 TTCCCTGTCCAACCCAGAAGAGG + Intergenic
951845407 3:27079539-27079561 TTCCCACCCCAGATCAGGAGAGG + Intergenic
952015985 3:28958550-28958572 CTCCTGCCCCAACTCCGAAGGGG - Intergenic
952269542 3:31817749-31817771 CTCCTACTCCACCTCAGAAGGGG + Intronic
953392655 3:42542795-42542817 TTCCAACCCCAACAAAGCAGGGG + Intergenic
953410324 3:42687224-42687246 GTCACACCCCAACTCAGACCTGG - Intronic
954765795 3:52914963-52914985 CTCCCTCCCCACCTCACAAGGGG - Intronic
955241614 3:57183083-57183105 CTCCCACTCCAATTCAGAAGGGG + Intergenic
956280666 3:67553079-67553101 CTCCCATCCCAACCAAGAAGTGG + Intronic
956603384 3:71047252-71047274 TCCCCACCCCTCCTCAGAGGAGG - Intronic
957653240 3:83035779-83035801 CTCCCCCTCCAACTCAGAAGGGG + Intergenic
957678588 3:83403654-83403676 CTCCTGCCCCAACTTAGAAGCGG - Intergenic
958100290 3:88999814-88999836 TTCCCCTCCCAGCACAGAAGTGG + Intergenic
958498514 3:94875329-94875351 CTACCTCACCAACTCAGAAGGGG + Intergenic
959586797 3:108032636-108032658 TACTCATCCCAGCTCAGAAGTGG - Intergenic
959863815 3:111243448-111243470 CTCCCACCCCAACTTGGAAGGGG + Intronic
960634396 3:119768767-119768789 CTCCCACCCCAACTCAGAAGGGG + Intergenic
961493471 3:127273970-127273992 CTCCTGCCCCAACTCAGAAGGGG - Intergenic
961943098 3:130657156-130657178 TTACCCTGCCAACTCAGAAGCGG + Intronic
962105404 3:132383676-132383698 CTCTCACCCCAACTCAGAAGGGG + Intergenic
962814171 3:138983606-138983628 TTCCCTCCCAAACTAAGAGGTGG - Intergenic
964090027 3:152864865-152864887 TTCCCACCACCACTTAGATGAGG - Intergenic
965005564 3:163018834-163018856 CTTCCTCTCCAACTCAGAAGGGG - Intergenic
965153199 3:165009859-165009881 TTCTCATCCCAACAGAGAAGAGG + Intronic
966491327 3:180531481-180531503 CTCCTGCCCCAACTCAGAAGGGG - Intergenic
967295112 3:187956874-187956896 CTCCCACCTCAGCTCAGAAAAGG + Intergenic
967649997 3:191974030-191974052 CTCCCACCCCAGCTTGGAAGGGG + Intergenic
968550824 4:1222694-1222716 TTCCAACCCCCACTCAGCACGGG + Intronic
969033355 4:4230661-4230683 TCCCCACCCCACCCCACAAGAGG + Intergenic
969937973 4:10701855-10701877 ATCCCACACCATCTCAGTAGTGG + Intergenic
972203744 4:36747365-36747387 CTCCTACCTTAACTCAGAAGGGG - Intergenic
974179066 4:58360946-58360968 CTGCCCCTCCAACTCAGAAGGGG + Intergenic
974278592 4:59759695-59759717 CTCCCGCCCCAACTGGGAAGGGG + Intergenic
975321199 4:73011625-73011647 TTGCCCTGCCAACTCAGAAGGGG - Intergenic
976516295 4:85970989-85971011 TTGCCACTCACACTCAGAAGAGG + Intronic
976675600 4:87698329-87698351 CTCCTGCTCCAACTCAGAAGGGG + Intergenic
979056792 4:116005588-116005610 TTCCCACCCCTAGGCAGAGGAGG + Intergenic
980750227 4:137077634-137077656 CTCTCACCCCAACTCAGAAGGGG + Intergenic
984705529 4:182844805-182844827 TGCCCTCCCCACCTCAGATGTGG + Intergenic
985786423 5:1897681-1897703 TTCCAACTCCAGCTCCGAAGAGG + Intergenic
986215217 5:5713152-5713174 CTCCCGTCCCAACTCAGAAGGGG + Intergenic
986587283 5:9331666-9331688 TTGCCACCCCCACCCACAAGTGG + Intronic
996057938 5:119001043-119001065 ATCCCTCCCCAACTGACAAGTGG - Intergenic
997895283 5:137710475-137710497 TTGTCACCCCAACTCAGAAAGGG + Intronic
997960286 5:138315919-138315941 CTCCTGCCCCAACTCAGAAGGGG - Intronic
999116601 5:149169559-149169581 TTCCCTCCCCAAGTCAGGAAAGG + Intronic
999156056 5:149458330-149458352 TTCCCACCTCAAATTACAAGAGG - Intergenic
999445565 5:151636179-151636201 CTCCCACCCCACCTCAGAACTGG + Intergenic
999799584 5:155020168-155020190 CTCCCGTCTCAACTCAGAAGGGG + Intergenic
1002319955 5:178369082-178369104 CTCCCACCCCAGGGCAGAAGGGG - Intronic
1002688881 5:181036952-181036974 CTCCCGCCCCATCTCAGAAGGGG - Intergenic
1003558141 6:7158706-7158728 TCCCCACCCCAACCTAGTAGTGG + Intronic
1004025479 6:11814255-11814277 TTCCCAGCAGAACTGAGAAGAGG + Intergenic
1004696899 6:18042591-18042613 CTCCTGTCCCAACTCAGAAGGGG - Intergenic
1006467290 6:34203186-34203208 TCCTGCCCCCAACTCAGAAGGGG + Intergenic
1006500759 6:34457605-34457627 CTCCCGCCCCAACTCAGAAAGGG - Intergenic
1006753657 6:36396298-36396320 CTCCTGCCCCAACTCAGAAGGGG - Intronic
1006867785 6:37222799-37222821 TTCCCGACTTAACTCAGAAGGGG + Intronic
1007037966 6:38695514-38695536 ATTCCACCCCAACCCAGCAGTGG - Intronic
1007087048 6:39155847-39155869 TCCCCACCCCAACTCTGGTGGGG - Intergenic
1007429539 6:41768765-41768787 GTCCAACCCCCACTCAGAGGAGG + Intergenic
1009610311 6:65931683-65931705 CTCCCACTCCAAATCAGAAGAGG + Intergenic
1010768841 6:79805767-79805789 TTGCCACCCCAACCCTAAAGGGG + Intergenic
1010883882 6:81214582-81214604 CTCCTGCCCCAACTCAGAAAGGG - Intergenic
1013236209 6:108199355-108199377 TTCCCATCCCAACTCAGAAAGGG + Intergenic
1013692891 6:112667182-112667204 CTCTTACCCCAACTCAGAAGGGG - Intergenic
1014289196 6:119539336-119539358 CTCCCACCCCAATTCAGAAGAGG - Intergenic
1014391558 6:120871934-120871956 CTTCCTCTCCAACTCAGAAGGGG - Intergenic
1015163186 6:130175349-130175371 TTTCCACCCCAACCCAGAAGTGG - Intronic
1015614562 6:135061742-135061764 ATTCCCACCCAACTCAGAAGAGG - Intronic
1015663569 6:135603015-135603037 CTCCTGCCCCAACTCAGAAGGGG - Intergenic
1016446068 6:144133106-144133128 CTCCCAAATCAACTCAGAAGAGG + Intergenic
1016737049 6:147490477-147490499 TTCCAGCCCCACTTCAGAAGAGG - Intergenic
1017054341 6:150424270-150424292 CTCCTGCCCCAACTTAGAAGGGG - Intergenic
1018674225 6:166205277-166205299 TGGCCACCCCATCTCACAAGGGG - Intergenic
1019280551 7:197755-197777 TTCCAACACCAACACTGAAGAGG + Intronic
1019898043 7:3998197-3998219 CTCCCGCCCCAACTCGTAAGGGG + Intronic
1020356136 7:7277823-7277845 CTCCCACCCTACCCCAGAAGAGG + Intergenic
1020568182 7:9823089-9823111 TTCCTGCCCCAACTCGGAAGTGG + Intergenic
1021561556 7:21972684-21972706 TGCCCCTCCCAACTCAGAAGGGG + Intergenic
1023790546 7:43750018-43750040 TTGCCCCACCAACTCGGAAGGGG + Intergenic
1024254653 7:47531773-47531795 TTCCCACCCCAACTCAGAAGGGG - Intronic
1024292131 7:47812326-47812348 TTCCCACCCCAACCCATGTGAGG + Intronic
1025288081 7:57685216-57685238 CTCCCATTCCAACTCGGAAGGGG - Intergenic
1028233181 7:88330013-88330035 CTCCCATCCCAATTCAGAAGGGG - Intergenic
1029538435 7:101169165-101169187 TCCCCTCCCCCACTCAGGAGTGG - Intergenic
1029973926 7:104815168-104815190 CTCCCACCCCAACTTAGAAGGGG + Intronic
1030567958 7:111184601-111184623 TTCCCACCCCACCTCAAAGTTGG + Intronic
1030906478 7:115189759-115189781 CTCCCACACCAAATCAGAGGTGG - Intergenic
1031936728 7:127742781-127742803 TTCCCACCACCACACAGTAGGGG - Intronic
1034946674 7:155266869-155266891 TTCCCACCCCAGGCCAGATGTGG - Intergenic
1035450832 7:158975987-158976009 CTCCCTTCCGAACTCAGAAGGGG - Intergenic
1038015898 8:23514487-23514509 TTCCCACCCCAACTCTTCAAAGG + Intergenic
1040725771 8:50379519-50379541 CTCCCACCCCAACTTTGAAGGGG + Intronic
1041740210 8:61150036-61150058 TTCCCAAAGCTACTCAGAAGTGG - Intronic
1042395929 8:68292396-68292418 CTCTCATCCCAACTGAGAAGGGG - Intergenic
1044525101 8:93242273-93242295 CTCCCACCCCAACTTGGAATGGG + Intergenic
1044775093 8:95678802-95678824 TTGCCCTGCCAACTCAGAAGTGG + Intergenic
1046140166 8:110081249-110081271 TTCCCACCCCCACCCTGAATAGG + Intergenic
1047773367 8:128048882-128048904 TCCCCATGCCAAGTCAGAAGAGG + Intergenic
1049021655 8:139961364-139961386 CTCCCACTCCAATTCAGAAGGGG - Intronic
1049251392 8:141591009-141591031 CTCCCACCTTCACTCAGAAGGGG - Intergenic
1049572910 8:143377999-143378021 TCCCCACCCCATCACAGAAGCGG - Intronic
1049823863 8:144654656-144654678 CTTCTGCCCCAACTCAGAAGGGG - Intergenic
1050130377 9:2406388-2406410 ATCCCACCCCAACTTGGAAGGGG - Intergenic
1050483851 9:6114087-6114109 CTCCCGCCCCAACTCGAAAGAGG - Intergenic
1051001681 9:12290418-12290440 CTCCCACCCCAATTCAGAAGGGG - Intergenic
1052860402 9:33434732-33434754 TCCCCACCCCAACATGGAAGTGG + Intergenic
1053076455 9:35138667-35138689 ATCCCATCCCAACTCAGAAGGGG - Intergenic
1053105971 9:35408173-35408195 TTCTTAACCCAACTCAGAAAAGG - Intergenic
1053617243 9:39781240-39781262 CTCATACCCCAACTCAGAAGGGG - Intergenic
1053875425 9:42540605-42540627 AACTCACCCCAACTCAGAAGGGG - Intergenic
1053897217 9:42754030-42754052 CTCATACCCCAACTCAGAAGGGG + Intergenic
1054236275 9:62561119-62561141 AACTCACCCCAACTCAGAAGGGG + Intergenic
1054266923 9:62926197-62926219 CTCATACCCCAACTCAGAAGGGG + Intergenic
1054550416 9:66595651-66595673 CTCATACCCCAACTCAGAAGGGG + Intergenic
1055471263 9:76613551-76613573 TTGCCACCCCACCTCACTAGAGG + Exonic
1055572512 9:77631911-77631933 CTTCCACCCCAACTCAGAAGGGG - Intronic
1056701855 9:88917782-88917804 TTCCCACCTCACATCAGATGTGG + Intergenic
1056985994 9:91364185-91364207 TTCCCACCCCAACTCAGAAGGGG - Intergenic
1056994538 9:91443729-91443751 TTGCCCCAACAACTCAGAAGGGG + Intergenic
1057279977 9:93702168-93702190 TTCCCACCCCCAGTCAGGACTGG + Intergenic
1057548366 9:96034686-96034708 TTCCCACCCAAACTCAGAAGGGG - Intergenic
1057667435 9:97056794-97056816 CTCCCACTCCCACTCAGATGAGG - Intergenic
1058091757 9:100813780-100813802 CTCCCACCCCAGCTCAGAAGAGG + Intergenic
1058472898 9:105299291-105299313 TTACCATCCCAATGCAGAAGAGG - Exonic
1059565394 9:115379484-115379506 CTCCCATCCCAATTCAGAAGGGG - Intronic
1062440906 9:136568820-136568842 TGCCCGCCCCAGCTCAGAGGAGG - Intergenic
1185625420 X:1478002-1478024 CTCCCACCCCATCACAGAGGAGG + Intronic
1185918254 X:4060279-4060301 TTTCCAGCCAACCTCAGAAGTGG + Intergenic
1186805729 X:13139002-13139024 CTCCTGCCCCAACTCAAAAGGGG - Intergenic
1187947968 X:24444932-24444954 TACCCACCCCAACTCTGAGGTGG + Intergenic
1189360032 X:40343361-40343383 CTCCAGTCCCAACTCAGAAGGGG - Intergenic
1189573100 X:42320767-42320789 TCCCCAGCCACACTCAGAAGCGG + Intergenic
1189856571 X:45229928-45229950 CTCCCACCTCAACTTGGAAGGGG + Intergenic
1189968931 X:46398550-46398572 TTCTCACCCTACCTCAGCAGAGG + Intergenic
1190445020 X:50515269-50515291 CTCCGGTCCCAACTCAGAAGGGG + Intergenic
1191221083 X:57989367-57989389 CTCCCATCCCAACTTAGAAGGGG - Intergenic
1194205218 X:91003291-91003313 CTCCCTTCCCAACTCAGAAGGGG + Intergenic
1194379211 X:93174494-93174516 CTCCTGCCCCAATTCAGAAGGGG - Intergenic
1194380142 X:93181217-93181239 TTCCCACCTCAACTCAGAAGGGG - Intergenic
1194383530 X:93224251-93224273 ATCCCATGCCAACTCAGCAGTGG - Intergenic
1195126367 X:101813237-101813259 TTCCCACGTCAACTTTGAAGGGG - Intergenic
1195179221 X:102340098-102340120 TTCCCACCAGAACTTCGAAGGGG + Intergenic
1197501261 X:127244555-127244577 CTCCCACCCCAACTTGGAAGGGG + Intergenic
1197951962 X:131907859-131907881 TTCCCGTCCCAACTCACAAGGGG - Intergenic
1198092280 X:133343415-133343437 ATCCCACCCCACCTCTTAAGTGG + Intronic
1199026290 X:142942640-142942662 CTACCACCCCAACTCACAGGTGG + Intergenic
1200551037 Y:4578428-4578450 CTCCCTTCCCAACTCAGAAGGGG + Intergenic
1201983216 Y:19930472-19930494 CCCCCACCTCAACTCAAAAGTGG - Intergenic