ID: 1056986944

View in Genome Browser
Species Human (GRCh38)
Location 9:91372000-91372022
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056986944_1056986947 28 Left 1056986944 9:91372000-91372022 CCTGTTAAGGAAGGCAATTTGCC No data
Right 1056986947 9:91372051-91372073 ACCTTATGCAAATCCATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056986944 Original CRISPR GGCAAATTGCCTTCCTTAAC AGG (reversed) Intergenic
No off target data available for this crispr