ID: 1056988071

View in Genome Browser
Species Human (GRCh38)
Location 9:91383492-91383514
Sequence CTAGGTACACAGATTAAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056988071_1056988075 27 Left 1056988071 9:91383492-91383514 CCGGGTTTAATCTGTGTACCTAG No data
Right 1056988075 9:91383542-91383564 TGTCAAACATTTAATCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056988071 Original CRISPR CTAGGTACACAGATTAAACC CGG (reversed) Intergenic
No off target data available for this crispr