ID: 1056992268

View in Genome Browser
Species Human (GRCh38)
Location 9:91423493-91423515
Sequence CCGCGCGCACTCGCCGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056992262_1056992268 18 Left 1056992262 9:91423452-91423474 CCCATCCTGACAAGGCAGCAAAA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG 0: 1
1: 0
2: 3
3: 21
4: 149
1056992263_1056992268 17 Left 1056992263 9:91423453-91423475 CCATCCTGACAAGGCAGCAAAAG 0: 1
1: 0
2: 3
3: 71
4: 595
Right 1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG 0: 1
1: 0
2: 3
3: 21
4: 149
1056992264_1056992268 13 Left 1056992264 9:91423457-91423479 CCTGACAAGGCAGCAAAAGTTTA 0: 1
1: 0
2: 2
3: 23
4: 199
Right 1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG 0: 1
1: 0
2: 3
3: 21
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056992268 Original CRISPR CCGCGCGCACTCGCCGCCGC TGG Intronic
900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG + Intronic
901425951 1:9182560-9182582 CCCCTCGCCCACGCCGCCGCTGG + Intergenic
901577181 1:10210522-10210544 CCGCCCGCAGTCGCCGGCGCGGG - Intergenic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903349952 1:22711328-22711350 CCACGCGCGCTCGCCGCCCCCGG + Intronic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
905867007 1:41382050-41382072 CAGCGCGCTGTCGCCGGCGCTGG + Exonic
912505051 1:110150610-110150632 CCGCGCGCTCTCTCCGCCGTGGG + Exonic
914197349 1:145454448-145454470 CCGGGCCCGCTCTCCGCCGCCGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
916107054 1:161440447-161440469 TCTCGCTCACTCGCCGCCTCGGG + Intergenic
920805690 1:209231772-209231794 CCCCGCGCGCTCGGCGCCGGTGG + Intergenic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922440730 1:225653257-225653279 CCGGGCGCACTCCCCCGCGCCGG + Intergenic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
924511202 1:244730459-244730481 CCGCGCGCCAGCCCCGCCGCCGG - Intergenic
1063458983 10:6203542-6203564 CCGGGCGCACTCGCCGTTTCCGG - Intronic
1065483515 10:26216311-26216333 CCGCCCGCACTTCCCGCCTCTGG + Exonic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070328585 10:75403043-75403065 CCGCGAGGACTCGCGGCGGCGGG - Intergenic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1075259405 10:120949648-120949670 CCGCGCCCAGTCGGCACCGCGGG + Intergenic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1081705673 11:45180916-45180938 CCCCTCCCAGTCGCCGCCGCCGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG + Intronic
1091613974 12:2035130-2035152 CCGGGCACACGCGCCGGCGCAGG - Intronic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1095465301 12:42483315-42483337 CCGCGTTCAGTCCCCGCCGCCGG + Intronic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096460876 12:51821001-51821023 GCGCGCGCCCTCGGCGGCGCCGG + Intergenic
1100329514 12:93571006-93571028 TCGCGCGCACTCGCTGCTCCTGG + Intronic
1103432965 12:120903910-120903932 CCGAGCGAGCCCGCCGCCGCCGG - Exonic
1105349421 13:19602181-19602203 CCCCGCACACTCCCCGCAGCTGG - Intergenic
1107133512 13:36920326-36920348 CCGCGCGCTCTGGCCGCTCCGGG + Intronic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1117424465 14:55580387-55580409 CCCCCCGCGCTCCCCGCCGCCGG - Intronic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1118808913 14:69260009-69260031 CCCCGCGCTCCAGCCGCCGCCGG - Exonic
1119559472 14:75578715-75578737 CCGGCCGCACACGCCGCAGCCGG - Exonic
1122145216 14:99684624-99684646 CCGCGCGCACTAGGCGAGGCCGG - Intronic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1126348038 15:47717323-47717345 CCGGGCGCGCTCGCCCTCGCGGG - Intronic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1132544730 16:527949-527971 CCGGGCCCGCTCGCCCCCGCCGG - Exonic
1132589788 16:721602-721624 CCGCGCGCTCGCGCCGACGTAGG - Exonic
1132778519 16:1610524-1610546 CCGCGGGGACTCGGCGGCGCCGG + Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132900445 16:2251362-2251384 CCGCGCGCCGTCTCCGCCGCCGG + Exonic
1139544791 16:67645115-67645137 CGGCGCGCACCTTCCGCCGCCGG + Exonic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1141430520 16:83968493-83968515 CCGCGGGGACTGGCCGGCGCCGG - Intergenic
1141972388 16:87492559-87492581 CGCCGCGCACCGGCCGCCGCTGG - Intergenic
1142206515 16:88785438-88785460 CCGCGCACGCTCGGAGCCGCGGG - Intergenic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142799775 17:2337813-2337835 CCGCGCCCACCCCCCGGCGCGGG + Intronic
1144269144 17:13600938-13600960 CCCCGCCTCCTCGCCGCCGCCGG + Exonic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1147643535 17:42020014-42020036 CCGCGCTCTCTCTCCGCTGCCGG + Intronic
1147994858 17:44354894-44354916 CCCGGCGCTCTCGCCCCCGCGGG + Exonic
1148111080 17:45144821-45144843 CCGCGTGCAGTCGCCGTCGGGGG + Intergenic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148437210 17:47694070-47694092 CCTCGCCCTGTCGCCGCCGCCGG - Intronic
1150764651 17:67993624-67993646 CCGCCCGCGCTCGCCACCGAGGG - Intronic
1151296858 17:73192576-73192598 TCGGGCGCGCTCGCCGCCGCTGG - Intergenic
1151875960 17:76868496-76868518 CCGCGCGCTCTCTCGCCCGCTGG - Intronic
1152781498 17:82229094-82229116 CCGCGCCTACCTGCCGCCGCTGG - Intronic
1153006226 18:500643-500665 CCGTCCTCCCTCGCCGCCGCCGG + Exonic
1153688350 18:7567769-7567791 GCGCGCCCACCCACCGCCGCCGG + Exonic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161069672 19:2253793-2253815 CAGCGCGCACTTGCCCCCGCAGG - Exonic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161477416 19:4494238-4494260 CCTCCTGCTCTCGCCGCCGCCGG - Exonic
1161494961 19:4581600-4581622 GCGCGCGCTCTCCCCGCCCCCGG + Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1163715183 19:18869127-18869149 CCGCGCGCACTGGCGGCCCCAGG + Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1165300208 19:34963850-34963872 CTGCGCGCTCTCGGCGCCCCCGG - Exonic
1165871420 19:38975819-38975841 CCGCCCGCCCTCGCTCCCGCTGG - Exonic
1165994286 19:39833398-39833420 CCGCTTGCCCTCCCCGCCGCGGG - Exonic
1166007144 19:39915629-39915651 CGGCACGCAGGCGCCGCCGCTGG + Exonic
926077349 2:9951812-9951834 TCGCGCCCGCTCGCCGCTGCCGG - Exonic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
934754635 2:96816607-96816629 GCGCCCGCACTCGGCGCTGCTGG + Exonic
939153808 2:138501762-138501784 CCGCGCGCACGCGCCCTCGCGGG + Intergenic
941095869 2:161238943-161238965 CCGCGCGTCCTTCCCGCCGCTGG + Intergenic
944563352 2:200963543-200963565 CCCCGCTGAGTCGCCGCCGCAGG + Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1169207779 20:3749728-3749750 GTGCCCGCGCTCGCCGCCGCAGG + Exonic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1170226463 20:13995983-13996005 CGGCGTGCACGCGCCGCCCCTGG + Intronic
1172144001 20:32743576-32743598 CCGCGGACACGCGCGGCCGCCGG + Exonic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1175859934 20:62144385-62144407 CCGGGCGCACTTGCGACCGCGGG + Intronic
1179632323 21:42686254-42686276 CAGCGCGCACTCACCGAGGCAGG - Exonic
1181478006 22:23180501-23180523 CGGCCCGCACTCTGCGCCGCAGG - Exonic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
951906951 3:27715359-27715381 CGCTGCGCACCCGCCGCCGCCGG - Intergenic
956129111 3:66038120-66038142 CCTCGGGCCCTCGCCGCCGCCGG + Exonic
958718935 3:97821903-97821925 CCGGGCGCAGCCGCCACCGCTGG - Intergenic
961013380 3:123449751-123449773 TCTCGCCCGCTCGCCGCCGCCGG + Exonic
962817943 3:139019908-139019930 CCACGCGCGCTCGCCGCTCCCGG - Exonic
968225434 3:196969518-196969540 CCGCGCGCCGTCGCCGACCCCGG - Intergenic
968583612 4:1406012-1406034 CGCCGCGCCCTCGCCGGCGCCGG - Exonic
969113855 4:4859670-4859692 CCGGGAGCACTCGCCGGCTCCGG - Exonic
969360047 4:6657741-6657763 CCACGCGCCCTCGCCTGCGCGGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
976053069 4:81031165-81031187 CCGTGCGCCCTCGCCCCAGCTGG + Exonic
978126836 4:105146176-105146198 CCGCGCGCACCCACCTCCTCCGG - Intronic
978432688 4:108650293-108650315 CCCCGCCCACTCGCTGACGCAGG - Intergenic
985995778 5:3596161-3596183 CCCCGGGCGCTCGCCGCCGTAGG - Exonic
989983095 5:50666612-50666634 CCGCGCACACTCGCGCCCGCGGG - Intronic
990210538 5:53478897-53478919 CCGCGCGCATTCGGTGCAGCAGG - Intergenic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
997485274 5:134225926-134225948 CTACACGCACACGCCGCCGCCGG + Exonic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
999727293 5:154446883-154446905 CCCCGGGCACTCCCCGCCGTGGG + Intronic
1002342443 5:178526029-178526051 CCGAGGACACTCGCCTCCGCTGG - Intronic
1002887871 6:1312176-1312198 CCTCGGGGACTCGCCTCCGCGGG + Intergenic
1006860904 6:37170892-37170914 CGGCGCGCCCTCCCCACCGCGGG - Intronic
1007701912 6:43770763-43770785 CCGCGTCCACTGTCCGCCGCCGG - Exonic
1008030318 6:46687834-46687856 CCCCGCCCACTCTCCGCGGCCGG + Intergenic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1014272574 6:119349938-119349960 CCCCGCGACCTCCCCGCCGCCGG - Intergenic
1014944052 6:127475953-127475975 CCGCGCGCTGTCGTGGCCGCCGG + Exonic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1019474544 7:1237591-1237613 CCGCGCGCACTGGCACACGCCGG + Intergenic
1019625445 7:2013620-2013642 TCGCTGGCACACGCCGCCGCCGG - Intronic
1020418205 7:7969441-7969463 CCGCCCGCCGTCGCCGCCGCCGG + Exonic
1022629427 7:32071129-32071151 CCGGGCACACTCACCCCCGCAGG + Intronic
1024335656 7:48203193-48203215 CCGCCCGCACTCGGAGCAGCCGG - Intronic
1029849339 7:103446084-103446106 CCGCGCGCACTCACCAGCCCGGG + Exonic
1032525633 7:132576896-132576918 CCCCGCGCACTCGCCGCGCCCGG - Exonic
1033306653 7:140230529-140230551 CGGCGCACTCTCGCCGCCCCGGG + Intergenic
1034469854 7:151249230-151249252 CCGGGCACACCCACCGCCGCCGG - Intronic
1034951094 7:155297664-155297686 ACGTGCGCACACGCCACCGCCGG - Intergenic
1035021391 7:155803092-155803114 CCGCGCGCACGGACCGCGGCGGG - Exonic
1038828561 8:31033202-31033224 CCGCTCGCACTGCCCCCCGCCGG + Exonic
1039903129 8:41767187-41767209 GCGCGCGCACCCGCACCCGCCGG + Intronic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1041792702 8:61714594-61714616 CCGCGCGCTCTCGCCCCGGGAGG - Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1044999771 8:97869275-97869297 CCGCGCTCACCTGCAGCCGCCGG - Exonic
1045509973 8:102806569-102806591 CCGCGCTCTCTCCCCGCCCCTGG + Intergenic
1045815163 8:106270303-106270325 AGGGGCGCACTCGCCGCCGCGGG + Intronic
1048345433 8:133571679-133571701 GCGCGCGCACTCACCACGGCTGG + Exonic
1049411443 8:142475627-142475649 CCGCCCGCACTCACGGCCGCAGG - Exonic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049718173 8:144103539-144103561 CCGCCCCCACTCACCGCCCCAGG + Exonic
1049803179 8:144527502-144527524 CCGCCCGCACGCTCCGGCGCCGG + Exonic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1053229964 9:36400406-36400428 CCGCGCCTCCTCGCCACCGCGGG + Intronic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1058619011 9:106863682-106863704 CCGCGCTCACTCCCCCCAGCAGG - Intronic
1060389958 9:123268806-123268828 CAGGGAGCACTCGCCGCCGGCGG + Intergenic
1061540704 9:131276802-131276824 CGGCGCCCACTCGCGGGCGCGGG + Intergenic
1061540903 9:131277478-131277500 TCGGGCGCGCTCGCCGCTGCCGG + Intergenic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1062696333 9:137877977-137877999 CCGGGCCCGCTCTCCGCCGCCGG - Exonic
1189335584 X:40168924-40168946 CCGCCCGCCCTGGCCGGCGCAGG + Intronic
1194035333 X:88863966-88863988 AGGCCCGCACTCGGCGCCGCCGG + Intergenic
1197754430 X:129984095-129984117 CCGCCCGCCCGCCCCGCCGCCGG - Intronic
1199699296 X:150364221-150364243 CCGCCCGCGCTAGCCGGCGCCGG - Intronic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic